ID: 938794598

View in Genome Browser
Species Human (GRCh38)
Location 2:134707012-134707034
Sequence ACCCGGAGGCTGCTTCTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938794598_938794602 4 Left 938794598 2:134707012-134707034 CCTCTCAGAAGCAGCCTCCGGGT No data
Right 938794602 2:134707039-134707061 CGTTCCCAAGCACACCCACAGGG No data
938794598_938794601 3 Left 938794598 2:134707012-134707034 CCTCTCAGAAGCAGCCTCCGGGT No data
Right 938794601 2:134707038-134707060 TCGTTCCCAAGCACACCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938794598 Original CRISPR ACCCGGAGGCTGCTTCTGAG AGG (reversed) Intronic
No off target data available for this crispr