ID: 938794601

View in Genome Browser
Species Human (GRCh38)
Location 2:134707038-134707060
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938794594_938794601 7 Left 938794594 2:134707008-134707030 CCCACCTCTCAGAAGCAGCCTCC No data
Right 938794601 2:134707038-134707060 TCGTTCCCAAGCACACCCACAGG No data
938794595_938794601 6 Left 938794595 2:134707009-134707031 CCACCTCTCAGAAGCAGCCTCCG No data
Right 938794601 2:134707038-134707060 TCGTTCCCAAGCACACCCACAGG No data
938794593_938794601 8 Left 938794593 2:134707007-134707029 CCCCACCTCTCAGAAGCAGCCTC No data
Right 938794601 2:134707038-134707060 TCGTTCCCAAGCACACCCACAGG No data
938794598_938794601 3 Left 938794598 2:134707012-134707034 CCTCTCAGAAGCAGCCTCCGGGT No data
Right 938794601 2:134707038-134707060 TCGTTCCCAAGCACACCCACAGG No data
938794590_938794601 18 Left 938794590 2:134706997-134707019 CCCTCCTGGTCCCCACCTCTCAG No data
Right 938794601 2:134707038-134707060 TCGTTCCCAAGCACACCCACAGG No data
938794589_938794601 21 Left 938794589 2:134706994-134707016 CCTCCCTCCTGGTCCCCACCTCT No data
Right 938794601 2:134707038-134707060 TCGTTCCCAAGCACACCCACAGG No data
938794588_938794601 27 Left 938794588 2:134706988-134707010 CCTGTTCCTCCCTCCTGGTCCCC No data
Right 938794601 2:134707038-134707060 TCGTTCCCAAGCACACCCACAGG No data
938794592_938794601 14 Left 938794592 2:134707001-134707023 CCTGGTCCCCACCTCTCAGAAGC No data
Right 938794601 2:134707038-134707060 TCGTTCCCAAGCACACCCACAGG No data
938794591_938794601 17 Left 938794591 2:134706998-134707020 CCTCCTGGTCCCCACCTCTCAGA No data
Right 938794601 2:134707038-134707060 TCGTTCCCAAGCACACCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type