ID: 938794602

View in Genome Browser
Species Human (GRCh38)
Location 2:134707039-134707061
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938794594_938794602 8 Left 938794594 2:134707008-134707030 CCCACCTCTCAGAAGCAGCCTCC No data
Right 938794602 2:134707039-134707061 CGTTCCCAAGCACACCCACAGGG No data
938794598_938794602 4 Left 938794598 2:134707012-134707034 CCTCTCAGAAGCAGCCTCCGGGT No data
Right 938794602 2:134707039-134707061 CGTTCCCAAGCACACCCACAGGG No data
938794590_938794602 19 Left 938794590 2:134706997-134707019 CCCTCCTGGTCCCCACCTCTCAG No data
Right 938794602 2:134707039-134707061 CGTTCCCAAGCACACCCACAGGG No data
938794591_938794602 18 Left 938794591 2:134706998-134707020 CCTCCTGGTCCCCACCTCTCAGA No data
Right 938794602 2:134707039-134707061 CGTTCCCAAGCACACCCACAGGG No data
938794592_938794602 15 Left 938794592 2:134707001-134707023 CCTGGTCCCCACCTCTCAGAAGC No data
Right 938794602 2:134707039-134707061 CGTTCCCAAGCACACCCACAGGG No data
938794593_938794602 9 Left 938794593 2:134707007-134707029 CCCCACCTCTCAGAAGCAGCCTC No data
Right 938794602 2:134707039-134707061 CGTTCCCAAGCACACCCACAGGG No data
938794589_938794602 22 Left 938794589 2:134706994-134707016 CCTCCCTCCTGGTCCCCACCTCT No data
Right 938794602 2:134707039-134707061 CGTTCCCAAGCACACCCACAGGG No data
938794595_938794602 7 Left 938794595 2:134707009-134707031 CCACCTCTCAGAAGCAGCCTCCG No data
Right 938794602 2:134707039-134707061 CGTTCCCAAGCACACCCACAGGG No data
938794599_938794602 -10 Left 938794599 2:134707026-134707048 CCTCCGGGTTTATCGTTCCCAAG No data
Right 938794602 2:134707039-134707061 CGTTCCCAAGCACACCCACAGGG No data
938794588_938794602 28 Left 938794588 2:134706988-134707010 CCTGTTCCTCCCTCCTGGTCCCC No data
Right 938794602 2:134707039-134707061 CGTTCCCAAGCACACCCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type