ID: 938795392

View in Genome Browser
Species Human (GRCh38)
Location 2:134714729-134714751
Sequence AGATTTTTACAGAGAGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938795392_938795396 1 Left 938795392 2:134714729-134714751 CCATCCTCTCTCTGTAAAAATCT No data
Right 938795396 2:134714753-134714775 CCCAAACCTTCCTTTGTGAGTGG No data
938795392_938795400 10 Left 938795392 2:134714729-134714751 CCATCCTCTCTCTGTAAAAATCT No data
Right 938795400 2:134714762-134714784 TCCTTTGTGAGTGGACTTGGAGG No data
938795392_938795402 11 Left 938795392 2:134714729-134714751 CCATCCTCTCTCTGTAAAAATCT No data
Right 938795402 2:134714763-134714785 CCTTTGTGAGTGGACTTGGAGGG No data
938795392_938795399 7 Left 938795392 2:134714729-134714751 CCATCCTCTCTCTGTAAAAATCT No data
Right 938795399 2:134714759-134714781 CCTTCCTTTGTGAGTGGACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938795392 Original CRISPR AGATTTTTACAGAGAGAGGA TGG (reversed) Intronic
No off target data available for this crispr