ID: 938801483

View in Genome Browser
Species Human (GRCh38)
Location 2:134767333-134767355
Sequence CAGTTTTTCTTAAATACAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938801483_938801490 25 Left 938801483 2:134767333-134767355 CCATTTGTATTTAAGAAAAACTG No data
Right 938801490 2:134767381-134767403 GGGAATAGGTAAATTAATTATGG No data
938801483_938801487 4 Left 938801483 2:134767333-134767355 CCATTTGTATTTAAGAAAAACTG No data
Right 938801487 2:134767360-134767382 TGATGAAAATATTCATTATGGGG No data
938801483_938801488 5 Left 938801483 2:134767333-134767355 CCATTTGTATTTAAGAAAAACTG No data
Right 938801488 2:134767361-134767383 GATGAAAATATTCATTATGGGGG No data
938801483_938801485 2 Left 938801483 2:134767333-134767355 CCATTTGTATTTAAGAAAAACTG No data
Right 938801485 2:134767358-134767380 AATGATGAAAATATTCATTATGG No data
938801483_938801486 3 Left 938801483 2:134767333-134767355 CCATTTGTATTTAAGAAAAACTG No data
Right 938801486 2:134767359-134767381 ATGATGAAAATATTCATTATGGG No data
938801483_938801489 11 Left 938801483 2:134767333-134767355 CCATTTGTATTTAAGAAAAACTG No data
Right 938801489 2:134767367-134767389 AATATTCATTATGGGGGAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938801483 Original CRISPR CAGTTTTTCTTAAATACAAA TGG (reversed) Intergenic
No off target data available for this crispr