ID: 938810960

View in Genome Browser
Species Human (GRCh38)
Location 2:134852428-134852450
Sequence AGAATATTGCCTACGATGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938810960_938810967 19 Left 938810960 2:134852428-134852450 CCAGCCATCGTAGGCAATATTCT No data
Right 938810967 2:134852470-134852492 TTAGGAAGTGAATTGGATGGTGG No data
938810960_938810964 1 Left 938810960 2:134852428-134852450 CCAGCCATCGTAGGCAATATTCT No data
Right 938810964 2:134852452-134852474 GATAGAGAATCAATGGTATTAGG No data
938810960_938810963 -6 Left 938810960 2:134852428-134852450 CCAGCCATCGTAGGCAATATTCT No data
Right 938810963 2:134852445-134852467 TATTCTGGATAGAGAATCAATGG No data
938810960_938810965 12 Left 938810960 2:134852428-134852450 CCAGCCATCGTAGGCAATATTCT No data
Right 938810965 2:134852463-134852485 AATGGTATTAGGAAGTGAATTGG No data
938810960_938810968 28 Left 938810960 2:134852428-134852450 CCAGCCATCGTAGGCAATATTCT No data
Right 938810968 2:134852479-134852501 GAATTGGATGGTGGCCTATCAGG No data
938810960_938810966 16 Left 938810960 2:134852428-134852450 CCAGCCATCGTAGGCAATATTCT No data
Right 938810966 2:134852467-134852489 GTATTAGGAAGTGAATTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938810960 Original CRISPR AGAATATTGCCTACGATGGC TGG (reversed) Intronic
No off target data available for this crispr