ID: 938814193

View in Genome Browser
Species Human (GRCh38)
Location 2:134883046-134883068
Sequence TCTACCTTCTGGACAGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938814193_938814199 7 Left 938814193 2:134883046-134883068 CCAGCACCTGTCCAGAAGGTAGA No data
Right 938814199 2:134883076-134883098 GATTCCAGATGAGGCAGCCATGG No data
938814193_938814197 -2 Left 938814193 2:134883046-134883068 CCAGCACCTGTCCAGAAGGTAGA No data
Right 938814197 2:134883067-134883089 GAATTCCAGGATTCCAGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938814193 Original CRISPR TCTACCTTCTGGACAGGTGC TGG (reversed) Intronic
No off target data available for this crispr