ID: 938814197

View in Genome Browser
Species Human (GRCh38)
Location 2:134883067-134883089
Sequence GAATTCCAGGATTCCAGATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938814194_938814197 -8 Left 938814194 2:134883052-134883074 CCTGTCCAGAAGGTAGAATTCCA No data
Right 938814197 2:134883067-134883089 GAATTCCAGGATTCCAGATGAGG No data
938814191_938814197 12 Left 938814191 2:134883032-134883054 CCTAATAAGGAAAGCCAGCACCT No data
Right 938814197 2:134883067-134883089 GAATTCCAGGATTCCAGATGAGG No data
938814189_938814197 26 Left 938814189 2:134883018-134883040 CCACTGCTTTACTGCCTAATAAG No data
Right 938814197 2:134883067-134883089 GAATTCCAGGATTCCAGATGAGG No data
938814193_938814197 -2 Left 938814193 2:134883046-134883068 CCAGCACCTGTCCAGAAGGTAGA No data
Right 938814197 2:134883067-134883089 GAATTCCAGGATTCCAGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938814197 Original CRISPR GAATTCCAGGATTCCAGATG AGG Intronic