ID: 938817445

View in Genome Browser
Species Human (GRCh38)
Location 2:134918703-134918725
Sequence CCGCGCATGCGCAAGGGCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 67}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938817433_938817445 29 Left 938817433 2:134918651-134918673 CCGAGGGCAGAAAAAGAAAGCAA 0: 1
1: 0
2: 6
3: 89
4: 768
Right 938817445 2:134918703-134918725 CCGCGCATGCGCAAGGGCGGAGG 0: 1
1: 0
2: 0
3: 4
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938817445 Original CRISPR CCGCGCATGCGCAAGGGCGG AGG Intronic
900549604 1:3247652-3247674 CTGCGCGGGCGCAAGGGCTGCGG - Intronic
902350067 1:15847797-15847819 CAGCGCATGCGCCCGGGCAGGGG - Intergenic
902400125 1:16152946-16152968 CCGCGCCCGCGTCAGGGCGGAGG - Intronic
902560138 1:17272216-17272238 CCGAGCATGCGCAAAGGCCCGGG + Intronic
906102670 1:43273126-43273148 CCGAGCAGGGGCAGGGGCGGCGG - Exonic
910968593 1:92832016-92832038 CTGCGCCTGCGCAAGGGCTGTGG + Exonic
912326422 1:108767622-108767644 CTGCACATGCGCAAGGTGGGCGG + Intronic
914710988 1:150213629-150213651 CTGCGCATGCGCGGGGGCGCAGG - Intergenic
916810896 1:168304826-168304848 CTGCTCATGGGCAAGGGCAGTGG + Intronic
924613152 1:245590246-245590268 CCGCGCATGCGCAGGGTCCCGGG + Intronic
1064033604 10:11898737-11898759 CCGCGAATTCACAAGGCCGGGGG - Intergenic
1064393191 10:14959283-14959305 ATGCGCATGCGCGAGGGCTGGGG - Intergenic
1075260349 10:120958180-120958202 AAGCTCATGGGCAAGGGCGGAGG + Intergenic
1076650180 10:131982019-131982041 CTGCGCGTGCGCAGGGGCGTGGG + Intergenic
1077010089 11:375786-375808 CCGCGCGGGGGCGAGGGCGGGGG + Intronic
1079407998 11:20162193-20162215 CCGCTCATGCTCATGGGCAGCGG + Intergenic
1092521796 12:9283643-9283665 GTGCGCATGCGCAGCGGCGGGGG + Intergenic
1092545488 12:9448213-9448235 GTGCGCATGCGCAGCGGCGGGGG - Intergenic
1094507465 12:31073838-31073860 GTGCGCATGCGCAGCGGCGGGGG + Intronic
1094839483 12:34336941-34336963 CCGCGCATGCGCAGGGTCCGGGG + Intergenic
1094841200 12:34343342-34343364 CCGCGCATGCGCAGGGTCCCAGG + Intergenic
1094845123 12:34358159-34358181 CCGCTCATGCGCAAGGCCCAGGG - Intergenic
1097261349 12:57721974-57721996 CTGCGCATGCCCAAAGGTGGAGG - Intergenic
1107364446 13:39655619-39655641 CCGCGCATGCGCATCGGCCCCGG - Intronic
1111951708 13:94713238-94713260 CCGAGCCGGCGCAGGGGCGGAGG + Intergenic
1121407939 14:93730238-93730260 CCACGCATTCGCAAGGGTGTGGG + Intronic
1122271233 14:100569189-100569211 CCGCGGGTGCGGAAGGGCAGTGG - Intronic
1132406215 15:101543053-101543075 CAGCGCATGCCCAAGGCCAGTGG - Intergenic
1139546661 16:67652946-67652968 CGGCGGAGGCGCTAGGGCGGCGG - Intronic
1143155396 17:4833354-4833376 CCGCGCCTGCGCAGGAGAGGTGG + Intergenic
1144775566 17:17783093-17783115 CCGCGCAGGCGAGAGGGAGGCGG + Intronic
1152952846 18:11083-11105 CGGCGCAGGCGCAGGCGCGGAGG + Intergenic
1152952854 18:11118-11140 CGGCGCAGGCGCAGGCGCGGAGG + Intergenic
1160867170 19:1261076-1261098 GTGCGCAGGCGCAAGCGCGGAGG + Intronic
1160896938 19:1407546-1407568 CCGGGCGTGCGCAGGGGCGGCGG + Intergenic
1162030920 19:7916928-7916950 CCGCGCACCCGCGATGGCGGCGG - Exonic
1163708489 19:18831831-18831853 CCGCGCACGCGCAGGGGGTGGGG - Intergenic
1164756937 19:30696655-30696677 TAGGGCATGCGCAATGGCGGGGG + Intronic
1165177890 19:33943325-33943347 CCGTGCATGTGCAAGGTGGGGGG + Intergenic
1168320074 19:55503839-55503861 GCACGCATGCGCAGGCGCGGTGG + Intronic
932355936 2:71068540-71068562 CCGCGCATGCGCACGCGCACAGG + Exonic
938817445 2:134918703-134918725 CCGCGCATGCGCAAGGGCGGAGG + Intronic
948046871 2:234951963-234951985 CCGCGCCTGGGCGGGGGCGGGGG - Intronic
1173166010 20:40687839-40687861 CCGGGCCGGGGCAAGGGCGGGGG + Exonic
1173488490 20:43458585-43458607 CCGGGCAGGCGCGAGGGCCGGGG + Intronic
1175358539 20:58389270-58389292 CGGTGCAGGCGCAGGGGCGGAGG - Exonic
1179977027 21:44874019-44874041 CCGCGCAGGCGCAGGAGCCGCGG - Intergenic
955365457 3:58306471-58306493 CCGCGCATGCGCCCGGGTCGCGG - Intronic
961858285 3:129893773-129893795 CGGCGCACGCGCAAGGGAGCGGG + Intergenic
976184615 4:82431111-82431133 CCAACCAAGCGCAAGGGCGGGGG - Intronic
985995848 5:3596422-3596444 CCGCGCCAGGGCAAGGGTGGCGG + Intronic
987050360 5:14143412-14143434 ACGCGCAGTCGCGAGGGCGGGGG - Intergenic
990565403 5:57022225-57022247 AAGCGCATTCTCAAGGGCGGGGG + Intergenic
992663553 5:78984739-78984761 CCGGGCATGCGCAGAGGCCGCGG + Intronic
999328278 5:150656764-150656786 GAGCGCATGCGCGGGGGCGGGGG - Intronic
1002928871 6:1620184-1620206 CGACGCATGCGCACGCGCGGTGG + Intergenic
1003871160 6:10404435-10404457 CTGCGCTTGCGCCGGGGCGGTGG - Intronic
1007585126 6:42984729-42984751 CCGCGCAGGCTCCAAGGCGGCGG - Intronic
1007800409 6:44387681-44387703 CTGCGCAAGCGCAAGGTGGGAGG - Exonic
1012450664 6:99349854-99349876 CCGCGCGCGGGCAAGGGCGGCGG + Intronic
1025615690 7:63114349-63114371 CCGCGCACGCCCAGGGGCTGGGG + Intergenic
1033477014 7:141701727-141701749 CCGGGCTTGGGGAAGGGCGGGGG - Intronic
1033654206 7:143362325-143362347 CCGCGCCTGCGGGAGGGCGACGG + Intronic
1035376723 7:158411433-158411455 CCGGGCATGTGCAAGGGCCCAGG - Intronic
1037496867 8:19448668-19448690 CCGCACATGAACAAGGGCAGAGG + Intronic
1047463582 8:125091635-125091657 CGGCGCACGCGCAGGGCCGGAGG + Exonic
1061580162 9:131531330-131531352 CCGCGCATGCGTGAGGGTGCAGG + Intergenic
1062372255 9:136245941-136245963 CCACGCATGGGCGGGGGCGGGGG - Intergenic
1185893245 X:3838170-3838192 CCAGGCATGCGCTGGGGCGGTGG - Intronic
1185898357 X:3876592-3876614 CCAGGCATGCGCTGGGGCGGTGG - Intergenic
1185903472 X:3915021-3915043 CCAGGCATGCGCTGGGGCGGTGG - Intergenic
1190268987 X:48847714-48847736 CCGCACCTCCGCCAGGGCGGCGG + Intergenic