ID: 938821605

View in Genome Browser
Species Human (GRCh38)
Location 2:134966178-134966200
Sequence TGCAATAAGCATGAGGATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938821603_938821605 -1 Left 938821603 2:134966156-134966178 CCTTTGTTATTGTGAATAGTGCT No data
Right 938821605 2:134966178-134966200 TGCAATAAGCATGAGGATGCAGG No data
938821602_938821605 4 Left 938821602 2:134966151-134966173 CCATACCTTTGTTATTGTGAATA No data
Right 938821605 2:134966178-134966200 TGCAATAAGCATGAGGATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938821605 Original CRISPR TGCAATAAGCATGAGGATGC AGG Intronic
No off target data available for this crispr