ID: 938840568

View in Genome Browser
Species Human (GRCh38)
Location 2:135158336-135158358
Sequence CGAGCAATCCAGGATGTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938840568_938840571 7 Left 938840568 2:135158336-135158358 CCTGGAACATCCTGGATTGCTCG No data
Right 938840571 2:135158366-135158388 GGAAGTGCTTTAAAAAAAGATGG No data
938840568_938840574 10 Left 938840568 2:135158336-135158358 CCTGGAACATCCTGGATTGCTCG No data
Right 938840574 2:135158369-135158391 AGTGCTTTAAAAAAAGATGGGGG No data
938840568_938840573 9 Left 938840568 2:135158336-135158358 CCTGGAACATCCTGGATTGCTCG No data
Right 938840573 2:135158368-135158390 AAGTGCTTTAAAAAAAGATGGGG No data
938840568_938840572 8 Left 938840568 2:135158336-135158358 CCTGGAACATCCTGGATTGCTCG No data
Right 938840572 2:135158367-135158389 GAAGTGCTTTAAAAAAAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938840568 Original CRISPR CGAGCAATCCAGGATGTTCC AGG (reversed) Intronic
No off target data available for this crispr