ID: 938841452

View in Genome Browser
Species Human (GRCh38)
Location 2:135168818-135168840
Sequence GTGCTGCCTCCTCCTGAGGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 375
Summary {0: 1, 1: 0, 2: 4, 3: 38, 4: 332}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938841447_938841452 24 Left 938841447 2:135168771-135168793 CCTTCTTCTGATTCTTCTAGCAT 0: 1
1: 0
2: 3
3: 12
4: 297
Right 938841452 2:135168818-135168840 GTGCTGCCTCCTCCTGAGGGAGG 0: 1
1: 0
2: 4
3: 38
4: 332

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938841452 Original CRISPR GTGCTGCCTCCTCCTGAGGG AGG Exonic
900092537 1:926677-926699 GAGCTGCCTTCTGCTCAGGGAGG + Intronic
900169456 1:1259493-1259515 GTGCTGCATCCTACACAGGGTGG - Intronic
900363677 1:2301785-2301807 TTGCTGCCTCCTCTTGAGGTTGG + Intronic
900602005 1:3506711-3506733 GTCCTTCCTCCTACTGAAGGCGG + Intronic
900683285 1:3930909-3930931 GGGCTGCTACCTCCTGAGGCAGG - Intergenic
900852575 1:5155689-5155711 TTGCTGCATCCTCCAGAGGAAGG + Intergenic
901181670 1:7346400-7346422 GAGCTGCCTCCTGCTGAGGACGG + Intronic
901206770 1:7502033-7502055 TTGCTGCTTCCTCCTCCGGGGGG - Intronic
901412757 1:9096030-9096052 GTGCTGAGTCCTCCTCTGGGTGG + Intergenic
901473506 1:9473540-9473562 GTGCTGCCTCCTGCAGGGGTGGG - Intergenic
901652797 1:10752617-10752639 GTGCTGGCTCTTCCAGAAGGAGG + Intronic
901684785 1:10937766-10937788 CTGCTGGCTCTTCCTGAGGGAGG - Intergenic
902584054 1:17427252-17427274 GTGGTGCCCTCTGCTGAGGGCGG - Intronic
903034911 1:20486825-20486847 GCGCTCCCTTCTCCTGCGGGAGG - Intergenic
903690310 1:25168608-25168630 TTACTGCCTCCTACTCAGGGAGG + Intergenic
903967840 1:27101142-27101164 GAGCTGCCACCTCCTGAGGATGG - Intronic
904009028 1:27379569-27379591 CTGCTGCCTCCTCTCGAGGCAGG - Exonic
905005487 1:34706300-34706322 ATTCTGCCACCTCCTGTGGGTGG - Intergenic
906814703 1:48866975-48866997 GTGCTGCCTCCTCTTGACTATGG - Intronic
906817992 1:48899001-48899023 GCGCTGCTTCCTCCAGAGGGCGG + Intronic
907328395 1:53655822-53655844 GTGGTGCCTCAACCTGAGGTTGG - Intronic
907858337 1:58326003-58326025 GGCCTGCCACCTCCAGAGGGAGG - Intronic
910348116 1:86264159-86264181 GTGTTGCTTCCTGCTGAAGGTGG + Intergenic
910773363 1:90851496-90851518 GCGCTGCCGCCTCCAGGGGGAGG + Intergenic
911182446 1:94873222-94873244 GTGCTGCATCCCCTTGAGGAGGG + Intronic
912344966 1:108955671-108955693 GTGCTGGCCCCTACAGAGGGTGG - Intronic
913434210 1:118830302-118830324 GTTATGCTTCCTCCTGTGGGTGG - Intergenic
914917617 1:151828084-151828106 ATGCTACCTCCTCCTGGGTGGGG - Intronic
915324904 1:155076663-155076685 GTGCTGCCTCCTTCAGTGAGAGG - Intergenic
917400040 1:174637669-174637691 TTCGTGCCTCCTCATGAGGGAGG + Intronic
917838736 1:178960747-178960769 ATGGTGACTCTTCCTGAGGGAGG - Intergenic
918120678 1:181536997-181537019 GTGCTCCCACCTACAGAGGGTGG - Intronic
918821303 1:189258518-189258540 CTGGTGCCTCTTCCTGTGGGAGG + Intergenic
919132448 1:193468460-193468482 ATGCTGCATCCTCCAGAGGCAGG + Intergenic
919800050 1:201348463-201348485 GGGCTGACTCCTTCTGAGGAAGG + Intergenic
920537489 1:206748156-206748178 GTGGTGCCACCTACTGAGGCTGG - Intergenic
921158762 1:212458236-212458258 TTGCTGCCTCGTCCTTGGGGTGG + Intergenic
922130497 1:222772341-222772363 GTCCTTCCTACTCCTGAGGCTGG + Intergenic
922583547 1:226717209-226717231 CTGCTGCCCCCTCCTGAGACAGG + Intronic
922705234 1:227787103-227787125 GTTCTCCCTCCTCCGCAGGGAGG - Intergenic
923365703 1:233258667-233258689 AAGCTCCCTCCACCTGAGGGTGG - Exonic
1062917059 10:1248523-1248545 CTGCAGCCTCCTCCTGAGAATGG - Intronic
1068021349 10:51589198-51589220 TTGCTGGCTTCTGCTGAGGGAGG + Intronic
1068701335 10:60023284-60023306 TAGCTGCCTCTCCCTGAGGGTGG - Intergenic
1069559082 10:69416949-69416971 GTGCTGCCTGCTCACGAGGGGGG + Intergenic
1069993465 10:72328898-72328920 CTCCTGCCACCTCCTCAGGGAGG - Intergenic
1070312436 10:75283514-75283536 GGCCTGCCTCTTCCTGAGGGTGG + Intergenic
1070320839 10:75353483-75353505 GCTCTGCCTCCTTCCGAGGGTGG - Intergenic
1070641578 10:78174116-78174138 GTTCTTCCTCCTTCTGAAGGCGG + Intergenic
1070778852 10:79126095-79126117 GTTCTGCCTCCTGCTGTGAGAGG + Intronic
1071109279 10:82136223-82136245 GAGCTGCCTTCAGCTGAGGGAGG + Intronic
1072954171 10:99874221-99874243 GCGCTGCCTGCGGCTGAGGGAGG + Intergenic
1074220703 10:111435007-111435029 AGGCTGTCTCCTTCTGAGGGTGG - Intergenic
1075795177 10:125115095-125115117 CTGCTGCCTCCTCTTGAGGCTGG + Intronic
1077151408 11:1074656-1074678 GGGCTGCCTCATCCTGAAGAAGG + Intergenic
1077282470 11:1751913-1751935 TTGATGCCTCTGCCTGAGGGTGG - Intronic
1077385652 11:2268407-2268429 CTGCTGCCTCCTCCGTAGGGTGG - Intergenic
1077412736 11:2411050-2411072 GGGCTGCCTCCTGCTTGGGGAGG - Intronic
1078123056 11:8530060-8530082 GTCCTGCCTGCTCCTTAGGATGG + Intronic
1079180897 11:18192634-18192656 CTCCTGCCTTTTCCTGAGGGAGG - Intronic
1079294344 11:19218930-19218952 CCACAGCCTCCTCCTGAGGGCGG - Intergenic
1079603836 11:22342255-22342277 GTTGTGGCTCCTCCTGGGGGAGG - Intronic
1080580087 11:33635192-33635214 GTGCTGCCTGTTACTGAGGAAGG - Intronic
1080659877 11:34286998-34287020 GTTCTGCCTCCTCATCATGGTGG + Intronic
1082790692 11:57344969-57344991 GTCCAGCCTCCACCTGAGGAAGG + Intronic
1083596497 11:63920379-63920401 GAGCTGCCCCCGCCTGCGGGAGG - Intergenic
1083656607 11:64232812-64232834 GTACTGCCTCCTCCTCATGCTGG + Exonic
1083665147 11:64270082-64270104 GTGCTGTCTCCTTTGGAGGGAGG - Exonic
1083674808 11:64319306-64319328 CCTCTTCCTCCTCCTGAGGGTGG + Intronic
1084350695 11:68597033-68597055 CCACTTCCTCCTCCTGAGGGTGG - Intronic
1084485056 11:69443375-69443397 GGGCCGCCTCCCCCCGAGGGAGG - Intergenic
1085279347 11:75320046-75320068 GGGCTGCCTCCTGCTCTGGGGGG - Intronic
1089659363 11:119975985-119976007 GTGCTGTTTCCTCTTGCGGGTGG - Intergenic
1090447486 11:126776416-126776438 CTGATGCCTCCTTCTCAGGGTGG + Intronic
1092330627 12:7583748-7583770 GTGCTCCCTCCTCCAGATGCTGG - Intergenic
1092712442 12:11353294-11353316 TTGCTGCCTCCTTGTGCGGGTGG + Exonic
1092716180 12:11393014-11393036 TTGCTGCCTCCTTGTGGGGGTGG + Exonic
1092716232 12:11393200-11393222 TTGCTGCCTCCTTGTGGGGGTGG + Exonic
1092796942 12:12121120-12121142 GTACAGACTCCTCCTGAGGAGGG - Exonic
1092919521 12:13218687-13218709 GTGAAGCCTACTCCTGAGGCGGG + Exonic
1094465715 12:30752381-30752403 GTAGTTCCTCCACCTGAGGGAGG + Intronic
1095227839 12:39698251-39698273 GTGCTCCATCCTCATGAAGGGGG + Intronic
1095485477 12:42680110-42680132 CATCTGCCTCCTACTGAGGGAGG - Intergenic
1096414259 12:51400040-51400062 GTGGTCCCTCCTCCTGGGTGTGG + Intronic
1096470027 12:51869819-51869841 GTGCTGACTCGTTCTGAAGGAGG + Intergenic
1097107844 12:56635710-56635732 GTGCAGCCCCCACCTGAAGGTGG + Intronic
1097586265 12:61519820-61519842 GGGTTGATTCCTCCTGAGGGAGG - Intergenic
1098191974 12:67958992-67959014 GTGCTTCCTCTTCCAGAGTGTGG + Intergenic
1101022480 12:100567311-100567333 GTTCTGCCTACTCCTGTGAGAGG - Intergenic
1102539466 12:113608228-113608250 GGGCTGCAGCCTCCTGAGAGAGG - Intergenic
1103854271 12:123954849-123954871 GTGCTCCCTCCTCCTGGGGTGGG - Intronic
1103985175 12:124762178-124762200 CTGCTGCCTTCTCCAAAGGGAGG + Intergenic
1104464334 12:128978432-128978454 GTGCGGCATCGTCCTGAGGTCGG + Intronic
1104869072 12:131981622-131981644 GTGCTGCCTGCTCCTGAGCGGGG - Intronic
1104887477 12:132119136-132119158 GAGCTGCCTGCTCCTGGGTGGGG - Intronic
1105938128 13:25120710-25120732 GAGCTGCCTGGTCCTGCGGGAGG - Intergenic
1106125621 13:26898045-26898067 GTGCGGCCCCCCGCTGAGGGTGG - Intergenic
1106384435 13:29270318-29270340 GGCCAGACTCCTCCTGAGGGGGG - Intronic
1106411513 13:29514448-29514470 CTGCTGCCACCTCCGGGGGGCGG + Exonic
1107359147 13:39601139-39601161 GTGCTGCCACCTCCTGCGTGGGG - Exonic
1107543978 13:41419775-41419797 TTAATGCATCCTCCTGAGGGTGG - Intergenic
1107791143 13:44003536-44003558 GTTCTGCTCCCTCCTGAGGTTGG + Intergenic
1110988769 13:82010181-82010203 GTGCTGCCTGCTCCTGCAAGAGG - Intergenic
1113257442 13:108522617-108522639 GGGTTGAGTCCTCCTGAGGGTGG + Intergenic
1115342162 14:32304469-32304491 GGGGAGCCTCCTCCTCAGGGTGG - Intergenic
1115667038 14:35562334-35562356 ATGCTGCCTCCTCCTTGGAGGGG + Intronic
1117286187 14:54287748-54287770 CAGATGCCTCTTCCTGAGGGAGG + Intergenic
1119126233 14:72129852-72129874 GTGGTGCCTCATCATGAGGTGGG - Intronic
1119443951 14:74648201-74648223 GTGCTGCCTCTTCCTGGTGCTGG - Intergenic
1119725021 14:76917023-76917045 GTACTTCCTCCTTCAGAGGGTGG + Intergenic
1121429039 14:93873973-93873995 GCTCTGCCCCCTCCTGAGGCTGG + Intergenic
1121538946 14:94710966-94710988 GGGCTGCCTCCTCCTGGCAGGGG - Intergenic
1122410451 14:101523082-101523104 GGGCTACCTCCTCCTGGGGGAGG - Intergenic
1122825639 14:104369121-104369143 GCGCTGCCTCCCCCTCAGGCAGG - Intergenic
1122922610 14:104886202-104886224 AGGCTGCCTCTTCCTGAGCGTGG + Intronic
1123016326 14:105377316-105377338 CTGCCTCCTCCTCCTCAGGGAGG - Intronic
1202839060 14_GL000009v2_random:103487-103509 TTGTTGCCTCCTCCTGAGTTTGG - Intergenic
1202894850 14_GL000194v1_random:1185-1207 GTGATGCCCCCTCTTGAGGAGGG + Intergenic
1202908427 14_GL000194v1_random:93578-93600 TTGTTGCCTCCTCCTGAGTTTGG - Intergenic
1202929201 14_KI270725v1_random:23651-23673 GTGCTGCCTGCACCGGGGGGTGG + Intergenic
1123423097 15:20147569-20147591 GTGCTGCCTGCACCGGGGGGTGG - Intergenic
1123505599 15:20939801-20939823 GTGCTGCCTGCACCCGGGGGTGG - Intergenic
1123532322 15:21154108-21154130 GTGCTGCCTGCACCGGGGGGTGG - Intergenic
1123562833 15:21513509-21513531 GTGCTGCCTGCACCGGGGGGTGG - Intergenic
1123599078 15:21950792-21950814 GTGCTGCCTGCACCGGGGGGTGG - Intergenic
1124250943 15:28106392-28106414 GTACAGCCTCCTCCTGGGTGAGG - Intergenic
1125853687 15:42928521-42928543 CTACTGCCTCCTACTGAGGCAGG - Intergenic
1126336515 15:47591149-47591171 TTGCTGCATCCTCATGAGGTGGG + Intronic
1126683483 15:51226486-51226508 GTGCTGAGTCCTGGTGAGGGAGG + Intronic
1128239960 15:66095144-66095166 ATGCTGCAGCCTCCTGAGGTGGG + Intronic
1128966185 15:72060885-72060907 GTGCTGCCTGGTGCTGGGGGAGG - Intronic
1130091427 15:80824320-80824342 GTGCCACCTGCTCTTGAGGGTGG + Intronic
1130387573 15:83424994-83425016 GTGCTGCCTCTTCCTGAAGAAGG - Intergenic
1131152969 15:90058372-90058394 GTCCTGCCTCCTCCTTGGGGTGG - Intronic
1132120976 15:99175107-99175129 CTGCTGCCTCCACTTGAGAGGGG + Exonic
1132295242 15:100729670-100729692 CTGGTGCCTCCACCGGAGGGTGG + Intergenic
1132892218 16:2209994-2210016 CTGCTTCCTCCGCCTGATGGAGG - Exonic
1133133770 16:3694914-3694936 GGGCTGGTTCCTCCTGAGGCTGG + Intronic
1133669696 16:8006358-8006380 GTGTTGCCTCCTTCTGAGCAGGG - Intergenic
1134865580 16:17603996-17604018 GGGCTCCATCCTCCTGGGGGTGG + Intergenic
1134922838 16:18132646-18132668 GTACTTCATCCTCCTGAGGTCGG + Intergenic
1135138040 16:19899100-19899122 GCCCTCCCTCCTCCTGAGGGTGG + Intergenic
1135387594 16:22057310-22057332 ATGCTGCATCCTCCTGAGGGAGG + Intronic
1135985161 16:27178746-27178768 GTCCTGCTTCCTCCCCAGGGAGG + Intergenic
1136378032 16:29876902-29876924 GAGCTGCCACCTCCGGAGTGGGG - Exonic
1137052106 16:35723122-35723144 GGGGTGCCTCCTCATGAGAGAGG + Intergenic
1137567510 16:49542716-49542738 GAGCTGCCTCCTCCCCAGGGTGG - Intronic
1137748363 16:50840377-50840399 GTGCTGTCTCCGGCTGAGGATGG + Intergenic
1138418044 16:56882514-56882536 TGGGTGCCTCCTCCTGAGGTGGG - Intronic
1141424453 16:83936021-83936043 ATGCTGCCTCCTGCTCTGGGTGG - Intronic
1141619232 16:85228023-85228045 CTGCTGCCTCCTCCACAGAGGGG - Intergenic
1142033541 16:87850285-87850307 ACGCTGCCTCCTCCTGTGTGGGG - Intronic
1144677862 17:17173374-17173396 CTGCTGCCAGCTCCTGAGGCAGG - Intronic
1144677954 17:17173898-17173920 GTGCTGCCCTCTCCCCAGGGAGG + Exonic
1145721423 17:27076511-27076533 GTGCAGTGTCTTCCTGAGGGAGG + Intergenic
1146288916 17:31594304-31594326 GAGCTGCCTCCTCTTGAATGGGG - Intergenic
1146578179 17:34012964-34012986 GGGCTGCCTCCTCCAGAGCCAGG - Intronic
1146923504 17:36729070-36729092 CTGGGGCCTCCTACTGAGGGAGG + Intergenic
1147214773 17:38892781-38892803 GTGCTGGCTTCCCCTGTGGGGGG - Intronic
1147269866 17:39261494-39261516 CTGCTGCCCCCTACTGATGGGGG + Exonic
1147438442 17:40432047-40432069 GTGATGCCTCCTCATGTGGTGGG + Intergenic
1149421067 17:56511162-56511184 GTGATGCGGCCTCCAGAGGGCGG - Intronic
1151202970 17:72482415-72482437 ATGATGCCCCCTCCTGAGGCTGG - Intergenic
1151966797 17:77435748-77435770 GTCCTGCAGCCACCTGAGGGAGG + Intronic
1152069355 17:78127376-78127398 GTGCTGCTTCCGCCTGGGGCTGG - Intronic
1152477060 17:80525431-80525453 GCACTGCCTCCTCCTGGTGGGGG - Intergenic
1152746614 17:82043302-82043324 GGTCTGTCCCCTCCTGAGGGTGG - Intergenic
1153944150 18:10004049-10004071 GTGCTGCCTTTTCCAGATGGTGG + Intergenic
1154172033 18:12059478-12059500 GTGCTGCCTGCACCAGGGGGTGG - Intergenic
1155238706 18:23846086-23846108 GTGATGTCTCCTCCTGTGGCAGG + Intronic
1155324142 18:24649253-24649275 TTGCTGCATCCTCTGGAGGGAGG + Intergenic
1156484689 18:37457299-37457321 GGGCTTCCTCCTCCTCAGAGTGG + Intronic
1158963911 18:62607430-62607452 GGGCTGGCTCCTCCTGAGGGCGG + Intergenic
1159651994 18:70988500-70988522 TTGCTGCATCCTCTGGAGGGAGG + Intergenic
1159980913 18:74778292-74778314 GTGCTCTCTCCTCCTGAGCAGGG + Intronic
1160125379 18:76166898-76166920 TTGCTGATTCCTACTGAGGGTGG - Intergenic
1160571051 18:79818006-79818028 GTGCTGCCTCCTCGCCAGGTGGG + Intergenic
1160809463 19:1007209-1007231 GAGCTGCCTCCGCCTGGGGTGGG + Intronic
1161066458 19:2240869-2240891 GTGCTGCCTCTTCCGCATGGAGG + Intronic
1161348531 19:3779605-3779627 GTGTTGCATCTTCCTGGGGGCGG + Exonic
1161453104 19:4357568-4357590 GTGATGCCTCCTCCCGAGGTAGG + Exonic
1161686220 19:5703986-5704008 GTGCCGCCGCCTCCTGTGGGGGG - Intronic
1161768409 19:6218962-6218984 CAGCTGCCTCCTCCTGATGGAGG - Intronic
1162861371 19:13507616-13507638 GTGCTTCCTCCTCCCCTGGGAGG + Intronic
1163161165 19:15464713-15464735 GTGCTGCCTCCCCGTCAGGGAGG - Intergenic
1163834254 19:19563525-19563547 CTCCAGCCTCCTCCTGGGGGAGG - Exonic
1164225753 19:23244344-23244366 GTGGTGCCTTGTCCTGAGAGGGG + Intronic
1164306428 19:24007809-24007831 GTGGTGCCTAGTCCTGAGAGAGG + Intergenic
1164554944 19:29244259-29244281 GAGCTGCCTGCCCCTGAGGTCGG + Intergenic
1164916295 19:32054877-32054899 CTGCTGCATCCTCTGGAGGGAGG + Intergenic
1165719823 19:38071142-38071164 GTGCTCCCTGGTCCTGAGTGAGG + Intronic
1168208185 19:54868136-54868158 GTGCAGCATCCTCATGAGAGTGG - Intergenic
1202633976 1_KI270706v1_random:27069-27091 TTGTTGCCTCCTCCTGAGTTTGG + Intergenic
1202651904 1_KI270707v1_random:12944-12966 TTGTTGCCTCCTCCTGAGTTTGG - Intergenic
925594258 2:5539708-5539730 GTGCTGGCTTCTCCTGCTGGGGG - Intergenic
926417952 2:12668924-12668946 GTGCAGCCTCCTCTTGCAGGGGG - Intergenic
929444166 2:41989866-41989888 GTTCAGCCTCCTCCTGAGCCTGG + Intergenic
929889556 2:45907773-45907795 CTGCTGCCTCCTTCTGAAGTGGG + Intronic
930682444 2:54271486-54271508 GTGCTGAGTCCTCCTTTGGGTGG - Intronic
930800911 2:55441720-55441742 TTGCTTCCTCCTCCTTAGAGAGG - Intergenic
932901877 2:75710701-75710723 GCGCGGCCTCCTCCAGAGGGCGG + Exonic
933019546 2:77174047-77174069 GTGCTGCCACCCCCTAAGGAGGG + Intronic
935428874 2:102951398-102951420 CTGCTGCCTTCTGATGAGGGTGG + Intergenic
937057632 2:118952765-118952787 GTGGTGCCTCCTCATGAAAGAGG + Intronic
937204338 2:120225890-120225912 CTGCTGCTTCCCCCTGAGTGTGG + Intergenic
938841452 2:135168818-135168840 GTGCTGCCTCCTCCTGAGGGAGG + Exonic
942051606 2:172146033-172146055 GTGCTGCTTCCTGCAGAGGGAGG + Intergenic
942187011 2:173433673-173433695 GTCCTGCTTCCTCCTGAATGTGG + Intergenic
943382922 2:187172949-187172971 TTACTGCCACCTCCTGTGGGAGG + Intergenic
945172419 2:207010893-207010915 CTCCTGCCTCCTGCTGTGGGTGG + Intergenic
945451741 2:210002496-210002518 GTCCCGCCTCCTCCTGGGGTGGG - Intergenic
947389225 2:229622498-229622520 GTGCTGACTCAGGCTGAGGGGGG - Intronic
947665639 2:231903853-231903875 ATGCTGCATCCTCTAGAGGGAGG + Intergenic
947999114 2:234553173-234553195 GGGCTGCATCCTCCAGAGGGAGG - Intergenic
948187890 2:236035671-236035693 GTGGTGCCTCCTCCTTTGGCGGG + Intronic
948696788 2:239736851-239736873 GTCCTGCCTTGTCCTCAGGGTGG - Intergenic
1170026252 20:11891555-11891577 GGGCGGCTTCCTCCTGAGGCTGG + Intronic
1170935298 20:20804629-20804651 GGGCTGCCTCCTTCAGGGGGTGG + Intergenic
1172227746 20:33316594-33316616 GCCCTGCCACTTCCTGAGGGTGG - Intergenic
1172511518 20:35504225-35504247 GGGCAGCCTCCTCCTGATGCCGG - Exonic
1172933422 20:38601783-38601805 GTTCAGCCTCCTCCTGGGGCGGG - Intergenic
1173852577 20:46228233-46228255 GTGCTGCCCTCTCCTGCCGGGGG - Intronic
1174094307 20:48075856-48075878 GTGCTGCATCCACCTGCAGGAGG + Intergenic
1175267826 20:57713295-57713317 GAGATGCCACCTCCTCAGGGAGG - Intergenic
1176178354 20:63738915-63738937 GTGCTCCTTCCTCCAGAGTGAGG + Exonic
1176614547 21:9017172-9017194 GTGATGCCCCCTCTTGAGGAGGG + Intergenic
1176627786 21:9108241-9108263 TTGTTGCCTCCTCCTGAGTTTGG - Intergenic
1176646189 21:9352850-9352872 TTGTTGCCTCCTCCTGAGTTTGG + Intergenic
1176710655 21:10146702-10146724 GTGATGCCCCCTCTTGAGGAGGG - Intergenic
1178495350 21:33081338-33081360 ATGCTGCCACCTGGTGAGGGGGG - Intergenic
1178608840 21:34062624-34062646 GTGCTGCATCCTCTGGAAGGAGG + Intergenic
1180366726 22:11946147-11946169 TTGTTGCCTCCTCCTGAGTTTGG - Intergenic
1180379356 22:12125059-12125081 TTGTTGCCTCCTCCTGAGTTTGG + Intergenic
1180418127 22:12787828-12787850 TTGTTGCCTCCTCCTGAGTTTGG - Intergenic
1180979556 22:19872225-19872247 CTGCTTCCTGCTCCAGAGGGTGG + Intergenic
1182483011 22:30621941-30621963 ATGCTGCTTTCTCCTGTGGGAGG + Intronic
1182630989 22:31685214-31685236 CTGCTGCTTCCTCCTGTGGATGG + Exonic
1184277694 22:43419575-43419597 GTGCTGAGTTCACCTGAGGGCGG + Intronic
1184892823 22:47390008-47390030 GAGCTGGGTCCTCCTGGGGGAGG - Intergenic
1185116751 22:48942257-48942279 GTGCTGCAGTGTCCTGAGGGTGG - Intergenic
1185180032 22:49354587-49354609 TTCCTTCCTCCTCTTGAGGGTGG + Intergenic
949724076 3:7023620-7023642 ATGCTGGTTCCTTCTGAGGGAGG + Intronic
950040657 3:9917256-9917278 GTGCTGCCCCCCCCCAAGGGGGG - Exonic
950517137 3:13474758-13474780 CTGCTGCCTTCTCCTGAGGAGGG - Intergenic
950584529 3:13882823-13882845 GTGCTGACTTCATCTGAGGGTGG - Intergenic
951599691 3:24359844-24359866 CTGGTGCCTCCACCAGAGGGTGG + Intronic
951853600 3:27170202-27170224 ATGCTGCCACCTCCTGAGTGGGG + Intronic
952421083 3:33132031-33132053 GTTTTGCCACCTCCTGAGGTTGG - Intronic
953515538 3:43587455-43587477 GTGGGGCCTTCTCCTGAAGGAGG - Intronic
954621239 3:51996836-51996858 GGGCTGCCTGGACCTGAGGGAGG + Intergenic
954979196 3:54728807-54728829 GTGCTGTCTCCTCCTTGGTGAGG + Intronic
954991428 3:54843860-54843882 GTGGTGCCGCCTACTGAGAGAGG + Intronic
955747882 3:62158051-62158073 GTACTGCTTCCTTCTGAGTGTGG + Intronic
956564975 3:70626022-70626044 TTGCTGCATCCTCCAGAGTGGGG - Intergenic
957040913 3:75334903-75334925 GTGGTGCCACATCCTGAGGATGG - Intergenic
957093997 3:75760516-75760538 TTGTTGCCTCCTCCTGAGTTTGG - Intronic
958612887 3:96450032-96450054 CTGCTGCCTCCTCCTTAGAGGGG + Intergenic
961454966 3:127019452-127019474 GTGCTCCCGCCTGCTGAGGCTGG + Intronic
961604157 3:128081468-128081490 GTGCTGCCTACTGATGTGGGGGG - Intronic
961930709 3:130529903-130529925 GTGCTGCCCTCTGCTGAGGAGGG - Intergenic
962801949 3:138898043-138898065 GAGCTGCGTCCTCTAGAGGGAGG + Intergenic
964213058 3:154249602-154249624 GTGTTCCCTCATACTGAGGGCGG + Intronic
965165144 3:165188201-165188223 GTGCTGTTTCCTCCTGGGGGAGG - Exonic
967993639 3:195150600-195150622 CTGCCGCTTCCTCCTCAGGGTGG + Intronic
1202740695 3_GL000221v1_random:52206-52228 TTGTTGCCTCCTCCTGAGTTTGG - Intergenic
968488943 4:879801-879823 GAGCTGCCTCCACCTCAGGCAGG - Intronic
968973461 4:3809074-3809096 GTGCTGCCGCCTCCGAGGGGAGG - Intergenic
969350417 4:6595006-6595028 GTGGTGCCTCCTGCTGGGAGCGG + Intronic
969428802 4:7140982-7141004 GGGCTGCCTCGTCCTGGGTGGGG + Intergenic
969655538 4:8495655-8495677 GTGCTGCCTGCTCCTGATTCTGG - Intergenic
970296397 4:14635662-14635684 ATGATGCCTCCTTCTGAGAGAGG - Intergenic
970443346 4:16103943-16103965 GTGCTGGCTCCTCCTCAAAGTGG + Intergenic
970640284 4:18057145-18057167 TTGCTGCCTCCTCCTCTGGAAGG + Intergenic
970993719 4:22241007-22241029 GTGCTTCCTACTCCTGTGTGTGG - Intergenic
972458703 4:39279318-39279340 GAGCTGCCGCTTCCTGAGGAAGG - Intronic
973032852 4:45365623-45365645 TTGCTGCATCCTCTTGGGGGAGG + Intergenic
973337096 4:48967703-48967725 GTGATGGCTCATCCAGAGGGTGG - Intergenic
973363662 4:49189461-49189483 TTGTTGCCTCCTCCTGAGTTTGG + Intergenic
973397418 4:49607280-49607302 TTGTTGCCTCCTCCTGAGTTTGG - Intergenic
974919473 4:68220724-68220746 GTACTGCCTGCTACTGATGGTGG - Intergenic
976468452 4:85398620-85398642 ATGCTGCATCCTCCTAAAGGAGG - Intergenic
977536278 4:98260279-98260301 GCCCTGGCTCCTCCTGAGTGGGG - Intergenic
980958676 4:139453802-139453824 GCGCGGCTTCCTCCAGAGGGCGG + Exonic
981651030 4:147059295-147059317 ATGCTGCCTCCTATGGAGGGAGG - Intergenic
984915534 4:184719688-184719710 GTGCTGCCTGGGCCTGGGGGAGG - Intronic
1202760976 4_GL000008v2_random:110542-110564 TTGTTGCCTCCTCCTGAGTTTGG + Intergenic
985539236 5:480183-480205 ATGCCGCCTCCTCCAGAGGGTGG + Intronic
985695312 5:1336868-1336890 CTGCTGCCTCCTCCTGACTGCGG - Intronic
986008984 5:3695098-3695120 CTGCTCCATCCTCCTGAGCGTGG - Intergenic
986170177 5:5308501-5308523 GTGCTCCCTCCTCCTTGGGATGG - Intronic
986723655 5:10578286-10578308 GTGCAGCCTCAACCTAAGGGTGG - Intronic
987064693 5:14277851-14277873 CTGCTGACTCCTCCTCAGGGAGG - Intronic
988563301 5:32300022-32300044 GAGCTGCCTACTTATGAGGGAGG - Intronic
992397380 5:76380444-76380466 GCCCGGCCTCCTCCTGGGGGTGG + Intergenic
993880765 5:93358085-93358107 GTGCTGCCTTCTAATGAGGCTGG - Intergenic
997519298 5:134512389-134512411 GTGCTCCCTCCTCCAGCAGGTGG - Intergenic
998897338 5:146813950-146813972 CTCCTGCCTTCTCCTGAGTGTGG - Intronic
999665002 5:153903854-153903876 GTGCTACCTCCTCTTGGAGGTGG - Intergenic
1001122055 5:168988775-168988797 GTGCTGCCTGCCCCTGGGGGGGG - Intronic
1001884281 5:175274773-175274795 ATGCTGCATTCTCCAGAGGGAGG - Intergenic
1006024350 6:31137980-31138002 GGTCTGGCTCCTCCTGAGGTCGG + Exonic
1006035807 6:31211070-31211092 GAGCTGCTTCCTGCTGAGTGCGG - Intergenic
1006379339 6:33688564-33688586 GTGTGGCTTCCTCCTGAGCGGGG + Intronic
1007261041 6:40563335-40563357 CTTCTGCCTCCTCCTCTGGGGGG + Intronic
1007308373 6:40924966-40924988 ACGCTGGCTCCTCCTGAGGTTGG - Intergenic
1007397186 6:41584710-41584732 GTGGTGCCTCCTCCTGGGTTGGG + Intronic
1007919755 6:45596075-45596097 GTTCTGCCTCCTTCTGTGGCTGG + Intronic
1015393911 6:132714346-132714368 GAGTTGGTTCCTCCTGAGGGCGG + Intergenic
1015460647 6:133487424-133487446 GTGATGCCTGGGCCTGAGGGAGG - Intronic
1016936087 6:149450527-149450549 CTGCTTCCTCCTCCTGAGCGGGG - Intronic
1017024132 6:150166704-150166726 CTGCTTCCTCCTCCTGAGGCAGG - Intronic
1017028146 6:150198438-150198460 GAGCTGCCCCTTGCTGAGGGAGG + Intronic
1017091319 6:150761919-150761941 TTGCTACCTCCTCCTGAAAGGGG - Intronic
1017124378 6:151051876-151051898 TGGCTGCGCCCTCCTGAGGGAGG + Intronic
1019909210 7:4089075-4089097 GTCTTACCTCCGCCTGAGGGAGG - Intronic
1021184574 7:17548484-17548506 GGGCTATATCCTCCTGAGGGAGG - Intergenic
1022505080 7:30904744-30904766 CTGCAGACTCATCCTGAGGGAGG + Intergenic
1023257154 7:38323398-38323420 GTGCTGCTTGCTCCAGAGGAAGG + Intergenic
1023956637 7:44891876-44891898 TTGCAGCCTCCTCCTTAGTGTGG - Intergenic
1024047028 7:45591882-45591904 GTGCTGGCTCCTTCTCAGGCTGG + Intronic
1026764588 7:73152493-73152515 GTGGTGCCTTCTCCTGAGGCAGG - Intergenic
1027041058 7:74962261-74962283 GTGGTGCCTTCTCCTGAGGCAGG - Intergenic
1027082579 7:75240112-75240134 GTGGTGCCTTCTCCTGAGGCAGG + Intergenic
1030627030 7:111855432-111855454 GTGCTGCCACCTACTGAGCCAGG + Intronic
1034263420 7:149770900-149770922 GGGTTGCAGCCTCCTGAGGGTGG + Intronic
1035234400 7:157487241-157487263 GTGCAGCCTCATCCTAAAGGAGG - Intergenic
1035359283 7:158299763-158299785 GCTCTGCCACTTCCTGAGGGAGG - Intronic
1035365779 7:158348832-158348854 GCACTGCCTCCTCCTGAGGGAGG - Intronic
1036105181 8:5830457-5830479 GGGGTGCCTCCTCATGAGAGAGG + Intergenic
1036226313 8:6960649-6960671 GTGTAGCCTCCTCCTGGGGCTGG + Intergenic
1038119854 8:24600992-24601014 GTGTTGGTTCCTTCTGAGGGGGG + Intergenic
1038335412 8:26641749-26641771 GTCCTCCCTCCTGCTGGGGGTGG + Intronic
1038751254 8:30298045-30298067 ATGCTGCATCCTCTGGAGGGAGG - Intergenic
1039615035 8:38948787-38948809 GTGTTGCGTTCTCCTGAAGGTGG + Intronic
1041024349 8:53668748-53668770 GTGCTACCTCCTCAGGAGTGGGG + Intergenic
1041088125 8:54275682-54275704 GTGCTGCATCCCTCTAAGGGCGG + Intergenic
1046240134 8:111478937-111478959 AAGCTGCCTCCTCCTGAGTGGGG - Intergenic
1047516162 8:125556577-125556599 GTGGGGCGTCCTCCTTAGGGGGG + Intergenic
1048791936 8:138112359-138112381 GGGCTGCCTTATGCTGAGGGAGG - Intergenic
1049004529 8:139846301-139846323 GTGCTGCCTGCTGCGGGGGGTGG - Intronic
1049092849 8:140529766-140529788 CTGCTGCCACCTCCTGCGTGCGG - Intergenic
1049311533 8:141936247-141936269 GGGCTTCCTGCTGCTGAGGGGGG - Intergenic
1049504443 8:142988248-142988270 TTCTTGCCTTCTCCTGAGGGTGG + Intergenic
1049641146 8:143716554-143716576 GTCCTGCCTCCTCCGTAGGCGGG + Intronic
1049744132 8:144256006-144256028 GTGGTGCCTTCTCCTGGGAGTGG + Intronic
1049790042 8:144468319-144468341 CCTCTGCCTCCTCCTGCGGGAGG - Exonic
1051336827 9:16073204-16073226 TTGCTGCCTCCTCCCCAGGATGG + Intergenic
1053446063 9:38154119-38154141 GGGCTGGCTCCTTCTGGGGGCGG + Intergenic
1053459651 9:38258419-38258441 ATGCTGCATCCTCTGGAGGGGGG + Intergenic
1053647641 9:40132398-40132420 GTGATGCCCCCTCTTGAGGAGGG - Intergenic
1053758090 9:41331445-41331467 GTGATGCCCCCTCTTGAGGAGGG + Intergenic
1054328618 9:63730352-63730374 GTGATGCCCCCTCTTGAGGAGGG - Intergenic
1054536938 9:66243772-66243794 GTGATGCCCCCTCTTGAGGAGGG + Intergenic
1054703825 9:68442394-68442416 GTGGTGGCTCCTGCTGAGGCAGG - Intronic
1060108041 9:120886684-120886706 GTGGTGCCTCTGCCAGAGGGCGG - Intronic
1060585466 9:124782739-124782761 GTGCTACCTCCTGATGGGGGCGG - Intronic
1060995733 9:127874127-127874149 GTGCTGCCAGCAGCTGAGGGCGG + Intronic
1062030219 9:134358824-134358846 GTGCTGCTTGCTCATGTGGGTGG + Intronic
1062467114 9:136686393-136686415 GGGCTGCCTGCTCCTGGGCGGGG - Intronic
1062521687 9:136960529-136960551 GTGCTGCCTGCAGCTGGGGGCGG + Intergenic
1202795415 9_KI270719v1_random:115690-115712 GTGATGCCCCCTCTTGAGGAGGG - Intergenic
1203750632 Un_GL000218v1:75920-75942 TTGTTGCCTCCTCCTGAGTTTGG - Intergenic
1203483360 Un_GL000224v1:28428-28450 TTGTTGCCTCCTCCTGAGTTTGG + Intergenic
1203709337 Un_KI270742v1:82143-82165 TTGTTGCCTCCTCCTGAGTTTGG - Intergenic
1203541746 Un_KI270743v1:95426-95448 TTGTTGCCTCCTCCTGAGTTTGG + Intergenic
1203621250 Un_KI270749v1:131014-131036 GTGCTGCCTGCACCGGGGGGTGG + Intergenic
1185536038 X:862339-862361 GACCTCCTTCCTCCTGAGGGTGG + Intergenic
1187031616 X:15493637-15493659 GTGCTGCCTCCACCGCTGGGAGG + Intronic
1190335623 X:49259984-49260006 TTGCTGTCACCTCCTGGGGGTGG + Intronic
1195255063 X:103082179-103082201 GTGCTGCCTCCTCCTGCAGAAGG + Intronic
1197488183 X:127080965-127080987 AAGCTGCATCCTCCAGAGGGAGG - Intergenic
1198795788 X:140392511-140392533 GTACTACCTTCTCATGAGGGTGG + Intergenic
1199412076 X:147535796-147535818 GTGCTGGCTCCTCTTGATCGGGG + Intergenic
1200153762 X:153964426-153964448 TTGCTGCCTTCTTCTGAGGTGGG + Intronic
1201164289 Y:11193597-11193619 TTGTTGCCTCCTCCTGAGTTTGG - Intergenic