ID: 938843299

View in Genome Browser
Species Human (GRCh38)
Location 2:135183305-135183327
Sequence CTCTTGATTCTGAGCAGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938843299_938843302 -10 Left 938843299 2:135183305-135183327 CCATGGCTGCTCAGAATCAAGAG No data
Right 938843302 2:135183318-135183340 GAATCAAGAGCGTTTGTGGGAGG No data
938843299_938843305 0 Left 938843299 2:135183305-135183327 CCATGGCTGCTCAGAATCAAGAG No data
Right 938843305 2:135183328-135183350 CGTTTGTGGGAGGTGGGAGTAGG No data
938843299_938843303 -7 Left 938843299 2:135183305-135183327 CCATGGCTGCTCAGAATCAAGAG No data
Right 938843303 2:135183321-135183343 TCAAGAGCGTTTGTGGGAGGTGG No data
938843299_938843306 7 Left 938843299 2:135183305-135183327 CCATGGCTGCTCAGAATCAAGAG No data
Right 938843306 2:135183335-135183357 GGGAGGTGGGAGTAGGATGCTGG No data
938843299_938843304 -6 Left 938843299 2:135183305-135183327 CCATGGCTGCTCAGAATCAAGAG No data
Right 938843304 2:135183322-135183344 CAAGAGCGTTTGTGGGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938843299 Original CRISPR CTCTTGATTCTGAGCAGCCA TGG (reversed) Intronic
No off target data available for this crispr