ID: 938856711

View in Genome Browser
Species Human (GRCh38)
Location 2:135320163-135320185
Sequence GCCTGTAGTCCCAGCTACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 789578
Summary {0: 71612, 1: 190254, 2: 237127, 3: 179987, 4: 110598}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938856711_938856712 -10 Left 938856711 2:135320163-135320185 CCTGAGTAGCTGGGACTACAGGC 0: 71612
1: 190254
2: 237127
3: 179987
4: 110598
Right 938856712 2:135320176-135320198 GACTACAGGCACATGCCACCAGG 0: 80
1: 436
2: 1411
3: 2826
4: 4767
938856711_938856716 24 Left 938856711 2:135320163-135320185 CCTGAGTAGCTGGGACTACAGGC 0: 71612
1: 190254
2: 237127
3: 179987
4: 110598
Right 938856716 2:135320210-135320232 GTGAAAGATTCTGAAGATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938856711 Original CRISPR GCCTGTAGTCCCAGCTACTC AGG (reversed) Intronic
Too many off-targets to display for this crispr