ID: 938856713

View in Genome Browser
Species Human (GRCh38)
Location 2:135320191-135320213
Sequence TCACTTTTAGCTCGGCCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938856713_938856716 -4 Left 938856713 2:135320191-135320213 CCACCAGGCCGAGCTAAAAGTGA No data
Right 938856716 2:135320210-135320232 GTGAAAGATTCTGAAGATTAAGG No data
938856713_938856717 11 Left 938856713 2:135320191-135320213 CCACCAGGCCGAGCTAAAAGTGA No data
Right 938856717 2:135320225-135320247 GATTAAGGTCCATAGTTGCATGG No data
938856713_938856718 12 Left 938856713 2:135320191-135320213 CCACCAGGCCGAGCTAAAAGTGA No data
Right 938856718 2:135320226-135320248 ATTAAGGTCCATAGTTGCATGGG No data
938856713_938856719 16 Left 938856713 2:135320191-135320213 CCACCAGGCCGAGCTAAAAGTGA No data
Right 938856719 2:135320230-135320252 AGGTCCATAGTTGCATGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938856713 Original CRISPR TCACTTTTAGCTCGGCCTGG TGG (reversed) Intronic