ID: 938856715

View in Genome Browser
Species Human (GRCh38)
Location 2:135320199-135320221
Sequence AGAATCTTTCACTTTTAGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938856715_938856717 3 Left 938856715 2:135320199-135320221 CCGAGCTAAAAGTGAAAGATTCT No data
Right 938856717 2:135320225-135320247 GATTAAGGTCCATAGTTGCATGG No data
938856715_938856719 8 Left 938856715 2:135320199-135320221 CCGAGCTAAAAGTGAAAGATTCT No data
Right 938856719 2:135320230-135320252 AGGTCCATAGTTGCATGGGAAGG No data
938856715_938856718 4 Left 938856715 2:135320199-135320221 CCGAGCTAAAAGTGAAAGATTCT No data
Right 938856718 2:135320226-135320248 ATTAAGGTCCATAGTTGCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938856715 Original CRISPR AGAATCTTTCACTTTTAGCT CGG (reversed) Intronic