ID: 938856716

View in Genome Browser
Species Human (GRCh38)
Location 2:135320210-135320232
Sequence GTGAAAGATTCTGAAGATTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938856714_938856716 -7 Left 938856714 2:135320194-135320216 CCAGGCCGAGCTAAAAGTGAAAG No data
Right 938856716 2:135320210-135320232 GTGAAAGATTCTGAAGATTAAGG No data
938856713_938856716 -4 Left 938856713 2:135320191-135320213 CCACCAGGCCGAGCTAAAAGTGA No data
Right 938856716 2:135320210-135320232 GTGAAAGATTCTGAAGATTAAGG No data
938856711_938856716 24 Left 938856711 2:135320163-135320185 CCTGAGTAGCTGGGACTACAGGC 0: 71612
1: 190254
2: 237127
3: 179987
4: 110598
Right 938856716 2:135320210-135320232 GTGAAAGATTCTGAAGATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938856716 Original CRISPR GTGAAAGATTCTGAAGATTA AGG Intronic
No off target data available for this crispr