ID: 938856718

View in Genome Browser
Species Human (GRCh38)
Location 2:135320226-135320248
Sequence ATTAAGGTCCATAGTTGCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938856713_938856718 12 Left 938856713 2:135320191-135320213 CCACCAGGCCGAGCTAAAAGTGA No data
Right 938856718 2:135320226-135320248 ATTAAGGTCCATAGTTGCATGGG No data
938856715_938856718 4 Left 938856715 2:135320199-135320221 CCGAGCTAAAAGTGAAAGATTCT No data
Right 938856718 2:135320226-135320248 ATTAAGGTCCATAGTTGCATGGG No data
938856714_938856718 9 Left 938856714 2:135320194-135320216 CCAGGCCGAGCTAAAAGTGAAAG No data
Right 938856718 2:135320226-135320248 ATTAAGGTCCATAGTTGCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938856718 Original CRISPR ATTAAGGTCCATAGTTGCAT GGG Intronic
No off target data available for this crispr