ID: 938856719

View in Genome Browser
Species Human (GRCh38)
Location 2:135320230-135320252
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938856715_938856719 8 Left 938856715 2:135320199-135320221 CCGAGCTAAAAGTGAAAGATTCT No data
Right 938856719 2:135320230-135320252 AGGTCCATAGTTGCATGGGAAGG No data
938856714_938856719 13 Left 938856714 2:135320194-135320216 CCAGGCCGAGCTAAAAGTGAAAG No data
Right 938856719 2:135320230-135320252 AGGTCCATAGTTGCATGGGAAGG No data
938856713_938856719 16 Left 938856713 2:135320191-135320213 CCACCAGGCCGAGCTAAAAGTGA No data
Right 938856719 2:135320230-135320252 AGGTCCATAGTTGCATGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type