ID: 938872884

View in Genome Browser
Species Human (GRCh38)
Location 2:135499663-135499685
Sequence TTCATTTTAGATATTCTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938872884_938872887 10 Left 938872884 2:135499663-135499685 CCTACCAGAATATCTAAAATGAA No data
Right 938872887 2:135499696-135499718 GGCAAAATGAAGTGTTGATGAGG No data
938872884_938872888 25 Left 938872884 2:135499663-135499685 CCTACCAGAATATCTAAAATGAA No data
Right 938872888 2:135499711-135499733 TGATGAGGATGAGATATAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938872884 Original CRISPR TTCATTTTAGATATTCTGGT AGG (reversed) Intronic
No off target data available for this crispr