ID: 938873867

View in Genome Browser
Species Human (GRCh38)
Location 2:135511813-135511835
Sequence AACTCTTCTTATGTCCATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938873867_938873875 9 Left 938873867 2:135511813-135511835 CCCCCATGGACATAAGAAGAGTT No data
Right 938873875 2:135511845-135511867 AAATCTATGCAGCATGTCTGGGG 0: 1
1: 0
2: 1
3: 15
4: 219
938873867_938873874 8 Left 938873867 2:135511813-135511835 CCCCCATGGACATAAGAAGAGTT No data
Right 938873874 2:135511844-135511866 AAAATCTATGCAGCATGTCTGGG 0: 1
1: 0
2: 0
3: 24
4: 202
938873867_938873873 7 Left 938873867 2:135511813-135511835 CCCCCATGGACATAAGAAGAGTT No data
Right 938873873 2:135511843-135511865 TAAAATCTATGCAGCATGTCTGG 0: 1
1: 0
2: 2
3: 8
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938873867 Original CRISPR AACTCTTCTTATGTCCATGG GGG (reversed) Intronic