ID: 938873869

View in Genome Browser
Species Human (GRCh38)
Location 2:135511815-135511837
Sequence GGAACTCTTCTTATGTCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 1, 2: 0, 3: 7, 4: 103}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938873869_938873874 6 Left 938873869 2:135511815-135511837 CCCATGGACATAAGAAGAGTTCC 0: 1
1: 1
2: 0
3: 7
4: 103
Right 938873874 2:135511844-135511866 AAAATCTATGCAGCATGTCTGGG 0: 1
1: 0
2: 0
3: 24
4: 202
938873869_938873873 5 Left 938873869 2:135511815-135511837 CCCATGGACATAAGAAGAGTTCC 0: 1
1: 1
2: 0
3: 7
4: 103
Right 938873873 2:135511843-135511865 TAAAATCTATGCAGCATGTCTGG 0: 1
1: 0
2: 2
3: 8
4: 159
938873869_938873875 7 Left 938873869 2:135511815-135511837 CCCATGGACATAAGAAGAGTTCC 0: 1
1: 1
2: 0
3: 7
4: 103
Right 938873875 2:135511845-135511867 AAATCTATGCAGCATGTCTGGGG 0: 1
1: 0
2: 1
3: 15
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938873869 Original CRISPR GGAACTCTTCTTATGTCCAT GGG (reversed) Intronic