ID: 938873870

View in Genome Browser
Species Human (GRCh38)
Location 2:135511816-135511838
Sequence AGGAACTCTTCTTATGTCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 1, 2: 0, 3: 13, 4: 143}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938873870_938873873 4 Left 938873870 2:135511816-135511838 CCATGGACATAAGAAGAGTTCCT 0: 1
1: 1
2: 0
3: 13
4: 143
Right 938873873 2:135511843-135511865 TAAAATCTATGCAGCATGTCTGG 0: 1
1: 0
2: 2
3: 8
4: 159
938873870_938873874 5 Left 938873870 2:135511816-135511838 CCATGGACATAAGAAGAGTTCCT 0: 1
1: 1
2: 0
3: 13
4: 143
Right 938873874 2:135511844-135511866 AAAATCTATGCAGCATGTCTGGG 0: 1
1: 0
2: 0
3: 24
4: 202
938873870_938873875 6 Left 938873870 2:135511816-135511838 CCATGGACATAAGAAGAGTTCCT 0: 1
1: 1
2: 0
3: 13
4: 143
Right 938873875 2:135511845-135511867 AAATCTATGCAGCATGTCTGGGG 0: 1
1: 0
2: 1
3: 15
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938873870 Original CRISPR AGGAACTCTTCTTATGTCCA TGG (reversed) Intronic