ID: 938873870 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:135511816-135511838 |
Sequence | AGGAACTCTTCTTATGTCCA TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 158 | |||
Summary | {0: 1, 1: 1, 2: 0, 3: 13, 4: 143} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
938873870_938873875 | 6 | Left | 938873870 | 2:135511816-135511838 | CCATGGACATAAGAAGAGTTCCT | 0: 1 1: 1 2: 0 3: 13 4: 143 |
||
Right | 938873875 | 2:135511845-135511867 | AAATCTATGCAGCATGTCTGGGG | 0: 1 1: 0 2: 1 3: 15 4: 219 |
||||
938873870_938873873 | 4 | Left | 938873870 | 2:135511816-135511838 | CCATGGACATAAGAAGAGTTCCT | 0: 1 1: 1 2: 0 3: 13 4: 143 |
||
Right | 938873873 | 2:135511843-135511865 | TAAAATCTATGCAGCATGTCTGG | 0: 1 1: 0 2: 2 3: 8 4: 159 |
||||
938873870_938873874 | 5 | Left | 938873870 | 2:135511816-135511838 | CCATGGACATAAGAAGAGTTCCT | 0: 1 1: 1 2: 0 3: 13 4: 143 |
||
Right | 938873874 | 2:135511844-135511866 | AAAATCTATGCAGCATGTCTGGG | 0: 1 1: 0 2: 0 3: 24 4: 202 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
938873870 | Original CRISPR | AGGAACTCTTCTTATGTCCA TGG (reversed) | Intronic | ||