ID: 938873874

View in Genome Browser
Species Human (GRCh38)
Location 2:135511844-135511866
Sequence AAAATCTATGCAGCATGTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 202}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938873867_938873874 8 Left 938873867 2:135511813-135511835 CCCCCATGGACATAAGAAGAGTT No data
Right 938873874 2:135511844-135511866 AAAATCTATGCAGCATGTCTGGG 0: 1
1: 0
2: 0
3: 24
4: 202
938873866_938873874 13 Left 938873866 2:135511808-135511830 CCAATCCCCCATGGACATAAGAA No data
Right 938873874 2:135511844-135511866 AAAATCTATGCAGCATGTCTGGG 0: 1
1: 0
2: 0
3: 24
4: 202
938873869_938873874 6 Left 938873869 2:135511815-135511837 CCCATGGACATAAGAAGAGTTCC 0: 1
1: 1
2: 0
3: 7
4: 103
Right 938873874 2:135511844-135511866 AAAATCTATGCAGCATGTCTGGG 0: 1
1: 0
2: 0
3: 24
4: 202
938873868_938873874 7 Left 938873868 2:135511814-135511836 CCCCATGGACATAAGAAGAGTTC No data
Right 938873874 2:135511844-135511866 AAAATCTATGCAGCATGTCTGGG 0: 1
1: 0
2: 0
3: 24
4: 202
938873870_938873874 5 Left 938873870 2:135511816-135511838 CCATGGACATAAGAAGAGTTCCT 0: 1
1: 1
2: 0
3: 13
4: 143
Right 938873874 2:135511844-135511866 AAAATCTATGCAGCATGTCTGGG 0: 1
1: 0
2: 0
3: 24
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938873874 Original CRISPR AAAATCTATGCAGCATGTCT GGG Intronic