ID: 938881893

View in Genome Browser
Species Human (GRCh38)
Location 2:135598827-135598849
Sequence CAAAGGAAAGAAAAGGATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938881893_938881900 25 Left 938881893 2:135598827-135598849 CCCCCATCCTTTTCTTTCCTTTG No data
Right 938881900 2:135598875-135598897 ACATTTTGACCCTTTCATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938881893 Original CRISPR CAAAGGAAAGAAAAGGATGG GGG (reversed) Intronic
No off target data available for this crispr