ID: 938887712

View in Genome Browser
Species Human (GRCh38)
Location 2:135670022-135670044
Sequence GCTTCTCTTGCCCAAGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938887712_938887717 -7 Left 938887712 2:135670022-135670044 CCAGCTCCTTGGGCAAGAGAAGC No data
Right 938887717 2:135670038-135670060 GAGAAGCACTTGAACCCAGGGGG 0: 92
1: 22317
2: 66338
3: 126010
4: 160364
938887712_938887716 -8 Left 938887712 2:135670022-135670044 CCAGCTCCTTGGGCAAGAGAAGC No data
Right 938887716 2:135670037-135670059 AGAGAAGCACTTGAACCCAGGGG No data
938887712_938887714 -10 Left 938887712 2:135670022-135670044 CCAGCTCCTTGGGCAAGAGAAGC No data
Right 938887714 2:135670035-135670057 CAAGAGAAGCACTTGAACCCAGG 0: 11
1: 1997
2: 43719
3: 116638
4: 168396
938887712_938887718 -1 Left 938887712 2:135670022-135670044 CCAGCTCCTTGGGCAAGAGAAGC No data
Right 938887718 2:135670044-135670066 CACTTGAACCCAGGGGGTTGAGG 0: 3
1: 291
2: 9671
3: 46334
4: 106411
938887712_938887715 -9 Left 938887712 2:135670022-135670044 CCAGCTCCTTGGGCAAGAGAAGC No data
Right 938887715 2:135670036-135670058 AAGAGAAGCACTTGAACCCAGGG No data
938887712_938887719 2 Left 938887712 2:135670022-135670044 CCAGCTCCTTGGGCAAGAGAAGC No data
Right 938887719 2:135670047-135670069 TTGAACCCAGGGGGTTGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938887712 Original CRISPR GCTTCTCTTGCCCAAGGAGC TGG (reversed) Intronic
No off target data available for this crispr