ID: 938890765

View in Genome Browser
Species Human (GRCh38)
Location 2:135702949-135702971
Sequence TGTTAGAGACAGCACTTTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938890765_938890767 9 Left 938890765 2:135702949-135702971 CCACTAAAGTGCTGTCTCTAACA No data
Right 938890767 2:135702981-135703003 ATACGCTGCTTGATGATGGCTGG No data
938890765_938890768 27 Left 938890765 2:135702949-135702971 CCACTAAAGTGCTGTCTCTAACA No data
Right 938890768 2:135702999-135703021 GCTGGTTCATCCTAATGCGCTGG No data
938890765_938890766 5 Left 938890765 2:135702949-135702971 CCACTAAAGTGCTGTCTCTAACA No data
Right 938890766 2:135702977-135702999 GCTAATACGCTGCTTGATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938890765 Original CRISPR TGTTAGAGACAGCACTTTAG TGG (reversed) Intronic
No off target data available for this crispr