ID: 938898427

View in Genome Browser
Species Human (GRCh38)
Location 2:135776314-135776336
Sequence ATGCTCCTCTAGAAGAGGCA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 135}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938898421_938898427 21 Left 938898421 2:135776270-135776292 CCGTCTTCCTGATGGTTCTTCCT 0: 1
1: 0
2: 2
3: 50
4: 481
Right 938898427 2:135776314-135776336 ATGCTCCTCTAGAAGAGGCAAGG 0: 1
1: 0
2: 1
3: 10
4: 135
938898423_938898427 1 Left 938898423 2:135776290-135776312 CCTTTACAAATCAGTTCCCTTCT 0: 1
1: 1
2: 1
3: 25
4: 297
Right 938898427 2:135776314-135776336 ATGCTCCTCTAGAAGAGGCAAGG 0: 1
1: 0
2: 1
3: 10
4: 135
938898422_938898427 14 Left 938898422 2:135776277-135776299 CCTGATGGTTCTTCCTTTACAAA 0: 1
1: 0
2: 0
3: 10
4: 227
Right 938898427 2:135776314-135776336 ATGCTCCTCTAGAAGAGGCAAGG 0: 1
1: 0
2: 1
3: 10
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938898427 Original CRISPR ATGCTCCTCTAGAAGAGGCA AGG Exonic
900282674 1:1881270-1881292 AAGCTGCTGTAGAAGAGGAAAGG - Intronic
903384627 1:22918335-22918357 AGGCTTCTCTAGAGGTGGCAGGG + Intergenic
906337564 1:44947158-44947180 CTGCTCCTCTAGAGAAGCCAGGG + Intronic
908841044 1:68280381-68280403 ACCCTCCTGTAGAAGAGGAAAGG - Intergenic
909825012 1:80116807-80116829 ATGCTCTTCTGGAAGAGTGAAGG + Intergenic
910289184 1:85583162-85583184 ATGCTCCTCAAGAATGAGCAAGG - Exonic
910473912 1:87586083-87586105 ATGCTCCTTTATAGGTGGCATGG + Intergenic
911597737 1:99816079-99816101 AGGCTTCTCTGGAAGAAGCACGG - Intergenic
916085642 1:161267067-161267089 CTGCACCTCTAGAACAAGCAGGG + Intronic
922158347 1:223058325-223058347 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
922374282 1:224945539-224945561 GTGTTCCTCTGGAGGAGGCAAGG + Intronic
924629629 1:245724423-245724445 ATGCTCCTCTAGAAGGTGTCTGG - Intergenic
1065039481 10:21676907-21676929 ATCCTTATCTAGAAGAGGCTTGG + Intronic
1069679070 10:70270834-70270856 AAGCTCCTCCAGTAGAGGAATGG - Intronic
1069921504 10:71818442-71818464 ATGGTCCCCTAGAAAAGACAGGG - Intronic
1072910611 10:99497622-99497644 ATGCAGCTCTAAAAAAGGCAGGG - Intergenic
1077517585 11:3011047-3011069 ATGATCCTCCAAAAGAGGAAAGG - Intronic
1078446078 11:11405942-11405964 ATGGTCCTCTACAACAAGCAAGG + Intronic
1081414185 11:42793676-42793698 ATGTTCCTTTAAAAGATGCATGG + Intergenic
1083011851 11:59408939-59408961 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1085479843 11:76812207-76812229 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1085525783 11:77162753-77162775 AAGCTCCTGAAGAAGAGACAGGG + Intronic
1087618909 11:100520234-100520256 CTGATCCTCAGGAAGAGGCAAGG + Intergenic
1088021621 11:105126192-105126214 ATGCACCTAAAGAAGTGGCATGG + Intergenic
1089504706 11:118955784-118955806 CTGCTGCTCTGGGAGAGGCAGGG - Intronic
1091313796 11:134596542-134596564 ATGCCTCTGTAGATGAGGCAAGG - Intergenic
1091546274 12:1503280-1503302 ATGCTGCTCCAGCAGGGGCAGGG + Intergenic
1091575207 12:1727594-1727616 CTGCTGCTCTGGGAGAGGCAGGG - Intronic
1092641262 12:10513259-10513281 ATGCTCCTCTGGGAGAATCAAGG + Intronic
1093000285 12:13988542-13988564 ATGCTACTCTAGAAGATAAAAGG - Intergenic
1093268994 12:17035678-17035700 TTACTCCTATAGAAGAGGCCAGG + Intergenic
1094167516 12:27457551-27457573 ATGCTTCTCAGGAAGAGGCTGGG - Intergenic
1095906149 12:47380111-47380133 ATGGTCCTCTGGAAGACCCAAGG + Intergenic
1096034710 12:48456406-48456428 TTGCTTCTCTAGATAAGGCAGGG - Intergenic
1098294417 12:68989988-68990010 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1104018189 12:124974378-124974400 CTGCTCCTGGAGAGGAGGCAGGG + Intronic
1110018403 13:70438176-70438198 ATAAACCTTTAGAAGAGGCAAGG + Intergenic
1113850451 13:113414601-113414623 ATGCTCCTCTTCCAGGGGCAGGG + Intergenic
1114912219 14:27214563-27214585 ATGCTCTTCTAAAAGAGTGAAGG + Intergenic
1115543767 14:34446647-34446669 ATGCCCTTCTAGAAGAGGGAAGG - Intronic
1116483920 14:45424040-45424062 ATGCCCTTCTAGAAGAGTAAAGG - Intergenic
1117251329 14:53942346-53942368 AGGCTTCTCTAGGAGAAGCAGGG - Intergenic
1118775929 14:68973996-68974018 AGGCCCCTCTAGCAGAGACATGG + Intronic
1121027647 14:90628342-90628364 AAGGTCCTCTAGGAGAGGAAGGG - Intronic
1121057411 14:90869978-90870000 ATCCTCCTCAAGAAGAGGCAAGG + Exonic
1121268139 14:92617970-92617992 ATGCCCTTCTAGAAGAGTGAAGG + Intronic
1125339288 15:38658816-38658838 ATGCTCCTCTGACAGAGGTAAGG - Intergenic
1133379464 16:5317982-5318004 ATGCTGCTGCTGAAGAGGCAGGG + Intergenic
1137848847 16:51718439-51718461 ATTTACCTCTAGAAGAAGCATGG - Intergenic
1137959911 16:52872134-52872156 ATTCTCTTCTGGAAGAGACATGG - Intergenic
1139345434 16:66300170-66300192 ATACCTCTCAAGAAGAGGCATGG - Intergenic
1140231847 16:73123805-73123827 ATGCCCTTATAGAAGAGGCCTGG + Intergenic
1140728379 16:77834286-77834308 AAGCTTCTATAGAACAGGCAAGG - Intronic
1140745304 16:77975575-77975597 CTGCTCCTCTAGAATAGTCTGGG + Intronic
1141994333 16:87627180-87627202 ATGCTCCTCAAGCTGAGCCACGG - Intronic
1144056190 17:11542966-11542988 AAGCTGCTCTGGGAGAGGCAGGG - Intronic
1149085461 17:52710296-52710318 ATGGGCCCCCAGAAGAGGCATGG - Intergenic
1149659544 17:58327122-58327144 AGGCTCCTGTAGAAGAGGGAAGG - Intronic
1152310178 17:79545267-79545289 GTGCTCCTCTAGCAGGGGCGAGG - Intergenic
1157199044 18:45643358-45643380 ATGTACCTCTAGGAGAGGGAGGG + Intronic
1158865886 18:61637189-61637211 CTGCTCCTCTAGAAAATGCATGG - Intergenic
1161504054 19:4634539-4634561 AAGCCCCTCTAGACTAGGCAAGG - Intergenic
1161698392 19:5782753-5782775 AGACTCCTCTGGCAGAGGCAGGG - Intergenic
926737342 2:16083472-16083494 GTGCTCCTCTAGAAGCAGCGGGG + Intergenic
929278449 2:40050927-40050949 ATGCCACTCTAGTAGAGGGAGGG + Intergenic
934940271 2:98496214-98496236 ATGCTCCTCTCCAAGAGGAGGGG + Intronic
937459034 2:122069710-122069732 ATGCTTCTCCAAAAGAGGCCTGG + Intergenic
938898427 2:135776314-135776336 ATGCTCCTCTAGAAGAGGCAAGG + Exonic
941857576 2:170246600-170246622 AGGCCACACTAGAAGAGGCAAGG + Intronic
944081876 2:195797320-195797342 CTGCCCCTTTAGAAGAGGCCTGG + Intronic
944819163 2:203411877-203411899 ATGCTTCCCTAGAAGACTCAAGG - Intronic
945993334 2:216414709-216414731 CTGCTCCTCTGTAAGAGGCAAGG - Exonic
948091666 2:235301071-235301093 GTGCTCCTCTAGATGGGGCTAGG + Intergenic
1172649215 20:36491291-36491313 AAGCTTCTCTAGAAGAAGCAAGG + Intronic
1173083491 20:39892200-39892222 CTGCAGCTCTAGAAGAAGCATGG + Intergenic
1173602135 20:44303404-44303426 ATGCTCCCAAGGAAGAGGCAAGG + Exonic
1174131420 20:48345986-48346008 ATGCTCCTTTAGAAGGTGCTTGG - Intergenic
1174545822 20:51324431-51324453 ATGGTCCTCTAGGAGAGCCGAGG + Intergenic
1175056248 20:56201303-56201325 ATGAGACACTAGAAGAGGCAGGG + Intergenic
1175208989 20:57336638-57336660 ATGCCTCTCAAGAAGAGGCTGGG + Intronic
1175229021 20:57461788-57461810 AGGTTCCTCCTGAAGAGGCAGGG + Intergenic
1176067168 20:63204069-63204091 ATGCCTCTCTAGAACTGGCAAGG + Intronic
1177781980 21:25631611-25631633 ATGCTCTTATAAAAGAGGCTTGG - Intergenic
1179609536 21:42540971-42540993 CTGCTGCTCTAGAAGACGCCTGG - Intronic
1182370332 22:29806043-29806065 CATCTCCTCTAGAAAAGGCAAGG + Intronic
1184232947 22:43168347-43168369 CTGCTTCTCTAGGAGAGGCCAGG + Intronic
1185325246 22:50222350-50222372 ATGCTCTTCTAGGAGAGGGCTGG - Intronic
951212954 3:19995451-19995473 TTTCTACCCTAGAAGAGGCATGG + Intronic
951775180 3:26302205-26302227 ATGCTACTATAGCAGAGACATGG - Intergenic
953179794 3:40584579-40584601 ATGCTCCTCTACAAGGTGCCAGG - Intergenic
961626319 3:128266371-128266393 ATGCTGCTCTAGATGAGGGATGG - Intronic
964802980 3:160574550-160574572 ATGGTCCACTAGAAGTCGCAGGG - Intergenic
965096069 3:164227733-164227755 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
965657055 3:170998609-170998631 ATTTTCCTGTAAAAGAGGCAGGG + Intronic
968386349 4:142529-142551 ATGCCCCTCTAGAAGAGTGAAGG - Intronic
976004095 4:80407512-80407534 ATGTTCTTCTGGCAGAGGCAGGG + Intronic
978950729 4:114555918-114555940 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
979900646 4:126212949-126212971 ATGTTCATCTAGACAAGGCAAGG - Intergenic
980499827 4:133634795-133634817 CTGCTACTCAAGAAGAGGAAAGG + Intergenic
986606684 5:9529773-9529795 AAGCTCCTCAAGAAGAGGGTGGG + Intronic
989665446 5:43848452-43848474 ATGATCCACTTGGAGAGGCAGGG + Intergenic
991495101 5:67218935-67218957 GAGCTCTTCTAGCAGAGGCATGG + Intergenic
992541047 5:77763976-77763998 ATGCTCATCAATAAGAGGAATGG + Intronic
994887509 5:105583173-105583195 ATGCTCCAGTGGAAGTGGCAGGG - Intergenic
997467439 5:134097682-134097704 ATGCTCCTCTGGACGTGGCGGGG + Intergenic
1000157759 5:158568571-158568593 ATGCTCATATAAAAGAGTCAAGG + Intergenic
1000535577 5:162473889-162473911 TTGCTCCTCTATAGGAGGAAGGG + Intergenic
1007366189 6:41395467-41395489 ATGTTCCTGTTGAACAGGCAGGG + Intergenic
1011123734 6:83983861-83983883 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1013565417 6:111354904-111354926 AGGGTACTCTAGTAGAGGCAAGG + Intronic
1014162944 6:118191088-118191110 ATGCCCTTCTAGAAGAGTAAAGG + Intronic
1014511934 6:122333111-122333133 ATGCTCCTAAAAAAGAGGTAAGG - Intergenic
1016215337 6:141593331-141593353 ACGCTCCTCTAGTAAAGGCAGGG - Intergenic
1016530639 6:145054953-145054975 AGGGTCCTCTAGTAGAGGAAAGG + Intergenic
1017382602 6:153847777-153847799 ATGATCCTCAAGCAAAGGCAAGG + Intergenic
1019270802 7:147277-147299 ATGCCCTTCTAGAAGAGGGAAGG + Intergenic
1020900266 7:13994751-13994773 ATGTTCCTCATGAAGAAGCATGG + Intergenic
1021377444 7:19925223-19925245 AAGCTCCTCAAAAAGAGGTATGG - Intergenic
1021821581 7:24503485-24503507 GTGCTCTTCTAGAGGAAGCAGGG - Intergenic
1022353657 7:29589379-29589401 ATGCTCCTCTGAAGGACGCAAGG + Intergenic
1024548348 7:50540572-50540594 CAGCTCCTCTAGAAGAGCCAGGG - Intronic
1027707634 7:81554292-81554314 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1030259082 7:107543830-107543852 AGGCTCCTCTGGCAGAGCCAGGG + Intronic
1031333118 7:120491069-120491091 ATGCTCCTATATGAGAAGCATGG - Intronic
1032188081 7:129744896-129744918 CTGCTCAGATAGAAGAGGCAGGG + Intronic
1032656122 7:133931919-133931941 AGCCTCTTCTAGAAGAAGCAAGG - Intronic
1033072369 7:138215865-138215887 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1033607613 7:142938992-142939014 ATGCTGCTCTACATGAAGCATGG - Intergenic
1033850007 7:145483438-145483460 ATGCCCTTCTAGAAGAGTAAAGG + Intergenic
1033962884 7:146935501-146935523 ATGCCCTTCTAGAAGAGTGAAGG - Intronic
1034688636 7:152996231-152996253 ATATTCCTCTAGAAGAGGAGAGG - Intergenic
1037912120 8:22749697-22749719 TTGCTCCTCTGTAAAAGGCAGGG - Intronic
1040089391 8:43381475-43381497 ATGCCCTTCTAGAAGAGTGAAGG + Intergenic
1041162832 8:55062263-55062285 GTGCTCATCTAGAAAAGGCCAGG - Intergenic
1046222827 8:111237736-111237758 ATGCACCCCTATAAGAGGGAGGG - Intergenic
1047595834 8:126377060-126377082 ATTCTCCTCTAGAAAAGTGAGGG - Intergenic
1048406569 8:134128497-134128519 CTGCTCCTGTAGCAGAGACATGG - Intergenic
1056578810 9:87875617-87875639 ATGGTCCTAGAGAGGAGGCAGGG + Intergenic
1056933034 9:90894257-90894279 ATGCTCCTGTACCAGAGGCTTGG + Intronic
1057428835 9:94976332-94976354 ATGCTTCTCTAGGGGTGGCATGG - Intronic
1061731334 9:132616698-132616720 ATACTCCTCTAGAGGTAGCAAGG + Intronic
1186443379 X:9604917-9604939 ATGATCCTCTGGGAGAGGCTTGG + Intronic
1186893395 X:13982372-13982394 ATGCCCTTCTAGAAGAGTGAAGG - Intergenic
1192495410 X:71613676-71613698 ACGCTCCTCTAGACGAGTCCTGG - Intergenic
1194515516 X:94847092-94847114 ATGTTCCTCTAGAAGATTAATGG - Intergenic
1196542576 X:116926451-116926473 ATGCTCTTGTAGAAGAGCAAAGG + Intergenic
1198216904 X:134563824-134563846 GTTTTCCTCAAGAAGAGGCAAGG + Intergenic