ID: 938899920

View in Genome Browser
Species Human (GRCh38)
Location 2:135791219-135791241
Sequence GTCCATTGGAAGCCTGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938899920_938899925 4 Left 938899920 2:135791219-135791241 CCAGCTCCAGGCTTCCAATGGAC No data
Right 938899925 2:135791246-135791268 GTGCTGTGTCTTCAGAGAATGGG No data
938899920_938899924 3 Left 938899920 2:135791219-135791241 CCAGCTCCAGGCTTCCAATGGAC No data
Right 938899924 2:135791245-135791267 AGTGCTGTGTCTTCAGAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938899920 Original CRISPR GTCCATTGGAAGCCTGGAGC TGG (reversed) Intronic
No off target data available for this crispr