ID: 938900745

View in Genome Browser
Species Human (GRCh38)
Location 2:135796824-135796846
Sequence CGGGCGCTCATCGGTTTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938900735_938900745 26 Left 938900735 2:135796775-135796797 CCCTGGCTCGGGCAAATGGTAGG No data
Right 938900745 2:135796824-135796846 CGGGCGCTCATCGGTTTTGCTGG No data
938900737_938900745 25 Left 938900737 2:135796776-135796798 CCTGGCTCGGGCAAATGGTAGGT No data
Right 938900745 2:135796824-135796846 CGGGCGCTCATCGGTTTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938900745 Original CRISPR CGGGCGCTCATCGGTTTTGC TGG Intronic
No off target data available for this crispr