ID: 938901324

View in Genome Browser
Species Human (GRCh38)
Location 2:135800770-135800792
Sequence GGCACTGCCCCCTACATTGT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 151}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938901324_938901330 12 Left 938901324 2:135800770-135800792 CCAACAATGTAGGGGGCAGTGCC 0: 1
1: 0
2: 0
3: 18
4: 151
Right 938901330 2:135800805-135800827 GACTCCTGGAAACATACACATGG 0: 1
1: 0
2: 2
3: 15
4: 196
938901324_938901328 -2 Left 938901324 2:135800770-135800792 CCAACAATGTAGGGGGCAGTGCC 0: 1
1: 0
2: 0
3: 18
4: 151
Right 938901328 2:135800791-135800813 CCAGGCCTATTGGAGACTCCTGG 0: 1
1: 0
2: 0
3: 11
4: 176
938901324_938901332 29 Left 938901324 2:135800770-135800792 CCAACAATGTAGGGGGCAGTGCC 0: 1
1: 0
2: 0
3: 18
4: 151
Right 938901332 2:135800822-135800844 ACATGGATGTCAACAGAGAATGG 0: 1
1: 0
2: 2
3: 29
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938901324 Original CRISPR GGCACTGCCCCCTACATTGT TGG (reversed) Exonic
900163455 1:1235444-1235466 GACACTGTCCCCTCCATGGTAGG - Intergenic
903953472 1:27009946-27009968 GCCACTGCCCCCTCCATGGCTGG - Intronic
904373462 1:30065546-30065568 AGCACTGCCCCCCACATTCCTGG + Intergenic
905502030 1:38447054-38447076 GGCACTGCCCTGTGCCTTGTAGG + Intergenic
911689704 1:100819315-100819337 GAGACTGCCCCGTGCATTGTAGG + Intergenic
912725884 1:112058415-112058437 GGGACTGTCCTCTGCATTGTAGG - Intergenic
912745537 1:112242699-112242721 GGCTTTGCCTCCTACATTGGAGG - Intergenic
916825053 1:168435132-168435154 AGCACAGCCCCCTACAGTGGTGG - Intergenic
917406392 1:174711728-174711750 GGCACTGCCCCCTACTCCGGGGG + Intronic
920245102 1:204582012-204582034 GGGGCTGCCCCGTGCATTGTAGG + Intergenic
921167422 1:212517032-212517054 GGTTCTGCCCCGTGCATTGTAGG - Intergenic
921574203 1:216815419-216815441 AACACTGCCCTCTAAATTGTTGG + Intronic
922865904 1:228861500-228861522 GGCACTGCCCTCTCCTTTCTTGG - Intergenic
924951778 1:248891202-248891224 GACACTGCCCACTACATTAATGG + Intergenic
1063036468 10:2290857-2290879 GGCAGTGCCCCCAACACTGCAGG + Intergenic
1063036501 10:2290995-2291017 GGCAGTGCCCCCAACATTGCAGG + Intergenic
1063981448 10:11455215-11455237 GACTCTGCCCCCTACATGCTGGG + Intronic
1064264302 10:13812500-13812522 GGCAGTGCCCTGTACATAGTAGG - Intronic
1067842386 10:49691378-49691400 GGCACTGCCCACGACACTTTTGG - Intronic
1070006842 10:72432781-72432803 GGCACAGCCTCCAACATTGCGGG + Intronic
1070691719 10:78532019-78532041 GGCACTGTCCTGTGCATTGTAGG - Intergenic
1072532908 10:96336328-96336350 GCCACTGCCCCCTGCATTTGAGG - Intronic
1072749067 10:97963542-97963564 GGCACAGCCCAGCACATTGTAGG + Intronic
1074695545 10:116047080-116047102 GGCACTGCCCCCAGAAATGTTGG - Intergenic
1074877275 10:117623172-117623194 GACAGTGCCACCTACATTCTGGG + Intergenic
1077433659 11:2528090-2528112 GGCTCTGCCCCCCACCTTATGGG - Intronic
1077844055 11:6005498-6005520 GGCATTGTCACGTACATTGTAGG + Intergenic
1078139903 11:8684476-8684498 GGCCCTGCCTCTGACATTGTCGG + Intronic
1081178289 11:39955781-39955803 GGGACTGCCCTGTGCATTGTAGG + Intergenic
1081695820 11:45108493-45108515 GGCACTGCCTCCTGCACTCTCGG + Intronic
1082141113 11:48610618-48610640 TGCACTGACACCTACTTTGTAGG + Intergenic
1083214363 11:61209293-61209315 GGGACTGTCCCGTGCATTGTAGG + Intronic
1083217247 11:61228122-61228144 GGGACTGTCCCGTGCATTGTAGG + Intronic
1083617792 11:64035215-64035237 GGCACTGCCCCCTTAATAGGTGG + Intronic
1085046980 11:73359405-73359427 TGCACTGCCCCCTCCTTTGTGGG + Intronic
1087397220 11:97615696-97615718 GGCACTGACGTCTACTTTGTTGG + Intergenic
1090188799 11:124754672-124754694 GGCAGTGCCCACCTCATTGTGGG + Exonic
1092127665 12:6086202-6086224 GGGACTGCCCCCTGGATTCTTGG + Intronic
1092193576 12:6536215-6536237 GGCACTGCCACCCACAGTCTGGG - Intronic
1092433282 12:8425944-8425966 GGCATTGCTCCCAATATTGTAGG + Intergenic
1094057734 12:26283831-26283853 CGCACTGCCACCCACATTGAGGG - Intronic
1096534413 12:52262115-52262137 GGCTCTGCCACTTACAATGTGGG + Intronic
1097943482 12:65339216-65339238 GGAGCTGCCCTATACATTGTAGG + Intronic
1099683456 12:85857143-85857165 AGCACTGCTCCCTACCTAGTTGG - Intergenic
1099688183 12:85916348-85916370 GGAACTGCTCATTACATTGTAGG + Intergenic
1101440901 12:104703698-104703720 GGCACTGCCCACTCCATTCCAGG + Intronic
1102534831 12:113573683-113573705 GGAACTGCACCCTACAGTATCGG + Intergenic
1102746440 12:115253165-115253187 GGCTCTGCCCTCTCCAGTGTGGG + Intergenic
1105344270 13:19559747-19559769 GGCAAGGCCCCCTACACTCTTGG + Intergenic
1105535764 13:21261827-21261849 GGCAAGGCCCCCTACACTCTTGG - Intergenic
1105593926 13:21818227-21818249 AGCACTGCCCCCTGCCCTGTGGG + Intergenic
1108669945 13:52675802-52675824 GGAATTGCCCAGTACATTGTAGG + Intronic
1109345755 13:61113350-61113372 GGCCCTGCCCCCTACTAAGTTGG + Intergenic
1110304988 13:73975959-73975981 GGCACTTCTCCATACAGTGTGGG - Intronic
1113295062 13:108950569-108950591 CTCACTGCCCCCTGCATTGCTGG + Intronic
1113849257 13:113408807-113408829 GGCACTGCCCACTGCAGTGCTGG - Intergenic
1113988498 13:114339096-114339118 GTCACTGGCCCCTGCAGTGTTGG + Intergenic
1119677855 14:76569308-76569330 GGAGCTGCCCCCTACATGGCAGG - Intergenic
1119751159 14:77078442-77078464 GGGGCTGCCCTGTACATTGTAGG + Intergenic
1120485554 14:85109522-85109544 GGCAGTGCCCCATACTTGGTAGG + Intergenic
1121833015 14:97068013-97068035 GACAATGCTCCCCACATTGTTGG - Intergenic
1122264626 14:100540851-100540873 ACCACTGCCCCCCACCTTGTGGG - Intronic
1125900926 15:43346419-43346441 GGGGCTGCCCCATGCATTGTAGG + Intronic
1128344528 15:66845166-66845188 GGCACTGCCCCACACATTGAAGG + Intergenic
1129804063 15:78439086-78439108 GCCACTGCCCCCTAGAATGTTGG + Intronic
1131256684 15:90867577-90867599 GACACTGCACTCTACATTGCAGG - Intergenic
1132879633 16:2156268-2156290 GGAGCTGCCCTGTACATTGTAGG + Intronic
1133964581 16:10521015-10521037 GGGACTGTCCCGTACACTGTAGG - Intergenic
1134300995 16:12990722-12990744 GGGCCTGCCCACTACATTGTGGG - Intronic
1138001482 16:53285014-53285036 GCCTCTGCCCCCTAAAGTGTTGG + Intronic
1138276712 16:55740484-55740506 CACACTGTCCCCTACATTGTCGG + Intergenic
1138282617 16:55783680-55783702 CACACTGTCCCCTACATGGTCGG + Intergenic
1138286327 16:55812940-55812962 CACACTGTCCCCTACATGGTCGG - Exonic
1141181328 16:81754816-81754838 GGAAATGCCTGCTACATTGTAGG + Intronic
1144164733 17:12599154-12599176 GGCTCTGATCCCTACATTGCAGG + Intergenic
1149542006 17:57474453-57474475 GGCACTGTCCTGTGCATTGTAGG + Intronic
1151777838 17:76220076-76220098 GGCACCCCCTCCTACTTTGTTGG - Intronic
1151828039 17:76534660-76534682 GGCACTGCCATCTACTTTGTTGG - Intronic
1152715913 17:81900617-81900639 GACACTGATCCCTACACTGTGGG - Intronic
1155190298 18:23423505-23423527 GGGACTGCCCTGCACATTGTAGG - Intronic
1156488124 18:37479414-37479436 GGGACTGTCCTGTACATTGTAGG + Intronic
1160013211 18:75122327-75122349 GTCACTGCCCTCTTCATTGATGG + Intergenic
1164707900 19:30333771-30333793 GGCACAGCCCACTAATTTGTGGG - Intronic
1168520582 19:57047283-57047305 TGCACAGCCCCCTTCAATGTGGG - Intergenic
925087244 2:1117731-1117753 TGCACTGCTCCCCACCTTGTGGG + Intronic
925332303 2:3068051-3068073 GGCACTTTCCTCTACATTGTGGG + Intergenic
928410214 2:31048771-31048793 GTCATTGCCCTCTTCATTGTAGG + Intronic
929644421 2:43612595-43612617 GGGACTGTCCCATGCATTGTAGG + Intergenic
930605758 2:53491498-53491520 GGGACTGCCCTGTACATTGTAGG - Intergenic
931612254 2:64114716-64114738 GGCACTGGCCTGTGCATTGTAGG + Intronic
931652685 2:64482777-64482799 GGCACTGCCCCCTCCCTGGCAGG + Intergenic
934579014 2:95423431-95423453 GGCAATGCCCATTACAGTGTGGG + Intergenic
934600433 2:95653272-95653294 GGCAATGCCCATTACAGTGTGGG - Intergenic
935890270 2:107669587-107669609 GGGACTGCTCCGTACATTGCAGG - Intergenic
938140138 2:128788064-128788086 GGATCTGCTCCCTACTTTGTGGG - Intergenic
938651605 2:133389173-133389195 GGAACTGCCCCCCACATTCTAGG + Intronic
938901324 2:135800770-135800792 GGCACTGCCCCCTACATTGTTGG - Exonic
939935834 2:148292604-148292626 TGCACTCCCACCAACATTGTAGG - Intronic
940248658 2:151648622-151648644 GGGGCTGCCCCGTGCATTGTGGG + Intronic
940557609 2:155251046-155251068 GGGGCTGCCCTCTAGATTGTGGG - Intergenic
942701433 2:178715521-178715543 GGCACTGCCTGCTGCATTGTGGG + Exonic
946419053 2:219554679-219554701 GGCACTGCCCCCCTCACTGATGG + Exonic
948465355 2:238149383-238149405 TGCACCACCCCCTTCATTGTGGG - Intronic
1169520687 20:6369923-6369945 GGCAGTGCCTGATACATTGTAGG - Intergenic
1170372214 20:15661689-15661711 GGTACTGCCCTGTAAATTGTAGG - Intronic
1171396727 20:24839163-24839185 AGCCCTGCCCCAGACATTGTCGG + Intergenic
1175404218 20:58716461-58716483 GGCACTGTCCCCTTCCCTGTGGG - Intronic
1178238233 21:30868765-30868787 GCCACTGCACCCAACATAGTGGG - Intergenic
1178470469 21:32887840-32887862 GGAACTGCCCTCCACATTCTTGG + Intergenic
1180683786 22:17649048-17649070 GCCTCAGCCCCCCACATTGTTGG + Intronic
1181741459 22:24924808-24924830 GGGACTGTCCCCTGCATTGTAGG + Exonic
1181987449 22:26810366-26810388 GGTACTGTCCCATGCATTGTGGG - Intergenic
949940121 3:9148337-9148359 GGCACTGCCCCCAAAATTGCTGG - Intronic
950893199 3:16423346-16423368 GGGACTGTCCTGTACATTGTAGG - Intronic
951629759 3:24706798-24706820 GACACTGCCACCTACATAGGGGG - Intergenic
953156875 3:40383623-40383645 GGAACTGCCCTGTATATTGTAGG - Intergenic
954146557 3:48637271-48637293 GGCAGTGGCACCTACATTCTGGG + Exonic
962215981 3:133522151-133522173 GTCACTGACGCCTACATTCTGGG - Intergenic
963716875 3:148812829-148812851 GGGACTGCCCTGTGCATTGTAGG - Intronic
968283283 3:197493213-197493235 GACACTGCCTCCCACATTGCAGG + Intergenic
976737900 4:88329072-88329094 GGCTCTGCCCCCTACCCTGGAGG - Intergenic
977180364 4:93866369-93866391 GCCACTGCCCCCTTCAATGTGGG + Intergenic
980085269 4:128384048-128384070 GGCACTGGCCCTTTCCTTGTAGG + Intergenic
983016671 4:162621788-162621810 GGCAGTGGCCCCAACATTTTTGG - Intergenic
985467557 5:12206-12228 GGCACTGCCCCCAACATCTGTGG + Intergenic
985468879 5:24692-24714 GACACTGGCCCCTGCAGTGTGGG - Intergenic
986570594 5:9160605-9160627 GGCACAGATCACTACATTGTAGG + Intronic
988468596 5:31514876-31514898 GGGACTGCCCTATGCATTGTAGG - Intronic
989313308 5:40046987-40047009 GACACAGCCTCCTTCATTGTTGG + Intergenic
990087861 5:52000921-52000943 GCCACTGCCCCTGATATTGTAGG + Intergenic
991262830 5:64685374-64685396 GCCACTGCACCCTGCACTGTGGG + Intergenic
992908553 5:81372547-81372569 GGCCCTGTCCCCTCCCTTGTTGG + Intronic
993977414 5:94499337-94499359 AGCATTCCCCCCTGCATTGTGGG + Intronic
997136395 5:131330684-131330706 GGCACTGTCCTGTGCATTGTGGG - Intronic
999436748 5:151569146-151569168 GGCACTGTCCTATGCATTGTAGG - Intergenic
999727852 5:154451784-154451806 GGGACTGTCCTCTGCATTGTAGG + Intronic
1001094635 5:168766694-168766716 GGCACTGCCCCTAACATGGCAGG - Intronic
1003829775 6:9995127-9995149 GGAGCTGCCCTCTGCATTGTAGG + Intronic
1004250541 6:14019776-14019798 GGGACTGTCCCATACATTGCAGG + Intergenic
1004271668 6:14201375-14201397 TGCACAGCCCCCTACATGGCTGG - Intergenic
1008633143 6:53382985-53383007 GACACTGCCACCTACATACTGGG + Intergenic
1009367002 6:62863738-62863760 GGCATTACTCCCTAAATTGTGGG - Intergenic
1011800067 6:91002813-91002835 GGGACTGTCCCCTACTTTGTAGG - Intergenic
1016104199 6:140141649-140141671 GGGGCTGCCCTGTACATTGTAGG - Intergenic
1020929468 7:14374770-14374792 GGCACTGTCCTGTGCATTGTAGG + Intronic
1022343370 7:29488804-29488826 GGGTCTGCCTCGTACATTGTGGG - Intronic
1023416399 7:39937196-39937218 GACACAGCCACCTTCATTGTAGG - Intergenic
1025682767 7:63693270-63693292 GGCCCTGCACGCTACATAGTTGG + Intergenic
1029666691 7:101999721-101999743 TGCACTGCCCCATACACAGTTGG + Intronic
1035386886 7:158478986-158479008 GCCACTGCCCCCAACAATGTGGG - Intronic
1037820892 8:22134022-22134044 GGCACTGCCCTCCACCTTGAGGG - Intergenic
1038387585 8:27163844-27163866 GGGGCTGCCCCATGCATTGTAGG + Intergenic
1041097194 8:54361705-54361727 GGCACTGCCCCAAACACTGGGGG + Intergenic
1045341021 8:101254571-101254593 GGCCCTGCCCCATACCTAGTAGG + Intergenic
1046265671 8:111825987-111826009 GGAGCTGTCCCATACATTGTAGG - Intergenic
1046328039 8:112675491-112675513 GGCACTGCTGACTACAGTGTAGG + Intronic
1048826125 8:138428930-138428952 GCCACTGCCTCCTACATAGTAGG - Intronic
1052046009 9:23794763-23794785 GGCAATGCTCCCTACAATCTGGG + Intronic
1059541244 9:115132655-115132677 GGAACTGCCCTGTGCATTGTAGG - Intergenic
1060109568 9:120896940-120896962 GGCCCTGCCCACTACACTCTGGG - Intergenic
1186411005 X:9344257-9344279 AGCACTGCCCGCCACATTCTGGG + Intergenic
1187354584 X:18555146-18555168 GGGACTGTCCCGTGCATTGTAGG + Intronic
1188092075 X:25976692-25976714 CTCACTGCCCCCTTCATTGTGGG - Intergenic
1191665185 X:63695211-63695233 GGGGCTGCCCTGTACATTGTAGG - Intronic
1193926512 X:87492658-87492680 GGGACTGCCTTCTGCATTGTAGG + Intergenic
1199520107 X:148725483-148725505 GGCACTTCCTCCAACTTTGTGGG + Intronic
1201474731 Y:14367897-14367919 GGCACAGCCCCCTTCATGGAAGG + Intergenic
1201741707 Y:17331406-17331428 GGGACTGCCCTTTGCATTGTAGG + Intergenic
1202274920 Y:23107365-23107387 AGCACTGACCCCTGCATAGTCGG - Intergenic
1202291108 Y:23313324-23313346 AGCACTGACCCCTGCATAGTCGG + Intergenic