ID: 938902819

View in Genome Browser
Species Human (GRCh38)
Location 2:135812471-135812493
Sequence GGATTCGTGTGGTGCCCTGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 115}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938902819_938902826 -6 Left 938902819 2:135812471-135812493 CCCCCAGGGCACCACACGAATCC 0: 1
1: 0
2: 1
3: 3
4: 115
Right 938902826 2:135812488-135812510 GAATCCAAGAGGATGAGGTCTGG 0: 1
1: 0
2: 0
3: 12
4: 257
938902819_938902828 -4 Left 938902819 2:135812471-135812493 CCCCCAGGGCACCACACGAATCC 0: 1
1: 0
2: 1
3: 3
4: 115
Right 938902828 2:135812490-135812512 ATCCAAGAGGATGAGGTCTGGGG 0: 1
1: 0
2: 2
3: 29
4: 486
938902819_938902830 6 Left 938902819 2:135812471-135812493 CCCCCAGGGCACCACACGAATCC 0: 1
1: 0
2: 1
3: 3
4: 115
Right 938902830 2:135812500-135812522 ATGAGGTCTGGGGCCACACATGG 0: 1
1: 0
2: 1
3: 17
4: 214
938902819_938902831 18 Left 938902819 2:135812471-135812493 CCCCCAGGGCACCACACGAATCC 0: 1
1: 0
2: 1
3: 3
4: 115
Right 938902831 2:135812512-135812534 GCCACACATGGTTCACGTGTTGG 0: 1
1: 0
2: 0
3: 1
4: 55
938902819_938902833 19 Left 938902819 2:135812471-135812493 CCCCCAGGGCACCACACGAATCC 0: 1
1: 0
2: 1
3: 3
4: 115
Right 938902833 2:135812513-135812535 CCACACATGGTTCACGTGTTGGG 0: 1
1: 0
2: 0
3: 6
4: 62
938902819_938902827 -5 Left 938902819 2:135812471-135812493 CCCCCAGGGCACCACACGAATCC 0: 1
1: 0
2: 1
3: 3
4: 115
Right 938902827 2:135812489-135812511 AATCCAAGAGGATGAGGTCTGGG 0: 1
1: 0
2: 2
3: 13
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938902819 Original CRISPR GGATTCGTGTGGTGCCCTGG GGG (reversed) Exonic
902526547 1:17062135-17062157 GGATTCTTCTGTTGCCCTGATGG + Intergenic
902888875 1:19426872-19426894 GGATTTGTCTGGTGACCTTGGGG + Intronic
904169198 1:28579682-28579704 GGATGCGTGTGAAGCTCTGGAGG - Intergenic
907580652 1:55569574-55569596 GGAGTAGTGTGGTGGGCTGGTGG - Intergenic
912616240 1:111102529-111102551 GGATTCCTGTGGTGCCAGGTAGG + Intergenic
915556117 1:156661689-156661711 AGATTAGTGCTGTGCCCTGGAGG - Intergenic
924625662 1:245694995-245695017 GGAGTCGTGTGGTGCCCCATTGG - Intronic
1068461070 10:57329510-57329532 GTATACGTCTGGTACCCTGGTGG + Intergenic
1074826576 10:117219208-117219230 GAAGTGGTGTTGTGCCCTGGTGG + Intergenic
1075455537 10:122582578-122582600 GGATTCTTGTGTTCCCCTGTAGG + Exonic
1075457660 10:122595281-122595303 GGATTCTTGTGTTCCCCTGTAGG + Exonic
1075458223 10:122598752-122598774 GGATTCTTGTGTTCCCCTGTAGG + Exonic
1077431803 11:2519277-2519299 GGGTTCGGGTGATGCCCTGTGGG + Intronic
1078639458 11:13081632-13081654 AGAGTCTTGTGGTGCCTTGGAGG + Intergenic
1090362854 11:126185550-126185572 GGATGCGTGCGGTGGGCTGGGGG - Intergenic
1090567218 11:128007367-128007389 GGATTCCTGTGGTTTGCTGGGGG - Intergenic
1090888149 11:130897620-130897642 GGATTGGTGTGGAGTCCTGATGG - Intronic
1104325729 12:127795479-127795501 GGATTTGTGTGGTGACCAGGCGG - Intergenic
1105811730 13:24001623-24001645 GGATGAGTGTGGTGCCCTGGTGG - Intronic
1117424317 14:55579888-55579910 GGAGCCAGGTGGTGCCCTGGAGG + Intronic
1118162228 14:63301950-63301972 GGATCCCTGTGGTGCCATGCAGG - Intergenic
1119472515 14:74908816-74908838 GGCTGGGTGTAGTGCCCTGGTGG - Intronic
1124988295 15:34645047-34645069 GTTTTGGTGTGATGCCCTGGAGG - Intergenic
1126850239 15:52791964-52791986 GGATTAGGATGTTGCCCTGGTGG - Intergenic
1127794801 15:62428248-62428270 GGAGTCGTGTTTTGCCATGGTGG + Intronic
1130849612 15:87780340-87780362 GGCTTCTTGTGGTGAACTGGGGG - Intergenic
1135116025 16:19724108-19724130 GGAATAGTATGGTGCACTGGAGG - Intronic
1135197655 16:20408040-20408062 GAATTCCTGTGGGGCCCTGTAGG + Intergenic
1135643690 16:24142951-24142973 GGGGTCGTGTGGTCCCCCGGAGG + Intronic
1135643790 16:24143577-24143599 GGGATCGTGTGATCCCCTGGAGG + Intronic
1136680647 16:31960109-31960131 GGATGCGTGAGGTGACCTGGGGG + Intergenic
1136680681 16:31960278-31960300 GGATGTGTGAGGTGACCTGGGGG + Intergenic
1136680765 16:31960656-31960678 GGATGTGTGAGGTGACCTGGGGG + Intergenic
1136780995 16:32901739-32901761 GGATGTGTGAGGTGACCTGGGGG + Intergenic
1136781046 16:32901989-32902011 GGATGTGTGAGGTGACCTGGGGG + Intergenic
1136781069 16:32902095-32902117 GGATGTGTGAGGTGACCTGGGGG + Intergenic
1136888773 16:33951930-33951952 GGATGTGTGAGGTGACCTGGGGG - Intergenic
1136888826 16:33952180-33952202 GGATGTGTGAGGTGACCTGGGGG - Intergenic
1137438838 16:48481954-48481976 CGATTCCTCTGGTGCCCTGTAGG + Intergenic
1138798064 16:59993639-59993661 GGATTCCTGTGGTGCCAGGAAGG + Intergenic
1140376941 16:74452295-74452317 TGAGTCCTGTGCTGCCCTGGAGG + Intronic
1203083591 16_KI270728v1_random:1165458-1165480 GGATGTGTGAGGTGACCTGGGGG + Intergenic
1203083742 16_KI270728v1_random:1166171-1166193 GGATGTGTGAGGTGACCTGGGGG + Intergenic
1148225644 17:45896366-45896388 GGATGGGTGGGGAGCCCTGGCGG + Intronic
1151244872 17:72786724-72786746 GGATTCTTGTACTGTCCTGGGGG + Intronic
1151500004 17:74482406-74482428 CAAGTCGTGTGGTGCCATGGAGG + Intronic
1154290779 18:13104335-13104357 GAATTCAGGTGGTACCCTGGTGG - Intronic
1160681392 19:413130-413152 GGAATCGGCTGGTGCCGTGGAGG - Intergenic
1163443564 19:17333879-17333901 GGAGTGGTGAGGAGCCCTGGCGG - Intronic
1164288048 19:23839723-23839745 GGATTCCTGTGGTGCCAGGCAGG + Intergenic
1165468634 19:35990120-35990142 GGAACCCTGTGATGCCCTGGAGG + Intergenic
1166709579 19:44927967-44927989 GTGTTTGTGTGGAGCCCTGGAGG + Intergenic
1166792858 19:45408298-45408320 GGATCCTTAGGGTGCCCTGGGGG - Exonic
1168106643 19:54169481-54169503 GGGTTTGGGTGGTGTCCTGGGGG - Intronic
1168258327 19:55179287-55179309 GGATGCCTGTGGGGCCGTGGAGG - Intronic
925144199 2:1570069-1570091 GGATCTGTGTGGTGGCCTCGTGG + Intergenic
930486588 2:52018255-52018277 GGATTCCTGTGGTGCCAGGCAGG + Intergenic
936403817 2:112185235-112185257 TGATGCATGTGGTCCCCTGGGGG - Exonic
938902819 2:135812471-135812493 GGATTCGTGTGGTGCCCTGGGGG - Exonic
940967457 2:159855699-159855721 GGTCACGTGTGATGCCCTGGAGG + Intronic
941627352 2:167844623-167844645 GGATCCTTGTGGTGCCCAGCAGG - Intergenic
946867403 2:224054742-224054764 GAAGCAGTGTGGTGCCCTGGAGG + Intergenic
1168765920 20:381517-381539 GGAGTCGTGTGGTGCGGTGAGGG + Intronic
1169356130 20:4907218-4907240 GGAATCGTGTGGTCTCCTGTGGG - Intronic
1170937339 20:20821703-20821725 GGATTCTAGTGGTGCCCAAGGGG - Intergenic
1175754978 20:61523677-61523699 GGAAGCGTGTGGTGCCCTCCTGG - Intronic
1178356312 21:31913004-31913026 GGCCTCCTGTAGTGCCCTGGTGG + Intronic
1179716307 21:43290530-43290552 GGATGCGGGTGGGGCTCTGGGGG - Intergenic
1179804648 21:43829535-43829557 GGACTCATCTGATGCCCTGGGGG - Intergenic
1181113991 22:20619721-20619743 GGCTTGCTGTGTTGCCCTGGTGG - Intergenic
1183351368 22:37336587-37336609 GGATTCCAGTGGTTCACTGGGGG - Intergenic
1185316892 22:50183211-50183233 GGTTTCTGGAGGTGCCCTGGGGG - Intergenic
956995776 3:74824947-74824969 GGATTCCTGTGGTGCCAGGCAGG + Intergenic
959046904 3:101484756-101484778 GGATTCCTGTGGTGCCAGGCAGG - Intronic
959436073 3:106316926-106316948 GGATTCCTGTGGTGCCAGGCAGG - Intergenic
960810247 3:121621451-121621473 CAATGCCTGTGGTGCCCTGGCGG - Exonic
960873680 3:122275871-122275893 TGATGAGTGTGGTGACCTGGTGG + Exonic
961434132 3:126904909-126904931 GGAAGGGTGGGGTGCCCTGGTGG + Intronic
963096833 3:141551482-141551504 GGATTCTTGTAGCTCCCTGGAGG + Intronic
965342903 3:167512070-167512092 GAATGGGTGTGCTGCCCTGGCGG - Intronic
966830733 3:184006132-184006154 CGATTGGTGTGGAGCCCAGGTGG - Intronic
968275274 3:197436559-197436581 GGATTAGAGTGGAGCCCTGCTGG + Intergenic
968275589 3:197438021-197438043 GGATTAGAGTGGAGCCCTGCTGG + Intergenic
973540537 4:51930879-51930901 GGATTATTCTGGTGCACTGGAGG + Intergenic
976619555 4:87114563-87114585 GGCTTCGGGTGGGGCCCGGGGGG - Exonic
977464933 4:97372009-97372031 GGTTTCATGAGGAGCCCTGGTGG + Intronic
978041307 4:104066494-104066516 GGATTGGTAAGGTGCCCTAGAGG + Intergenic
978468453 4:109034935-109034957 GGATTCATATGATGCCCTGATGG + Intronic
985549348 5:525096-525118 GCATCCGTGTGAAGCCCTGGGGG - Intergenic
991532544 5:67631972-67631994 GGATTAATTTGGTCCCCTGGAGG - Intergenic
998426729 5:142035215-142035237 GGGTGCCTGAGGTGCCCTGGAGG + Intergenic
999258472 5:150222927-150222949 GGATGGGAGTGTTGCCCTGGAGG - Intronic
1001546737 5:172575083-172575105 GGGGTGGGGTGGTGCCCTGGGGG - Intergenic
1003172006 6:3727279-3727301 TGGTTCGTGTGGGGCCCTGAGGG - Intronic
1019375833 7:691482-691504 GGATGGCTGTGGTGCGCTGGGGG - Intronic
1022365703 7:29713553-29713575 TGATTCATCTGGTGCCCTTGTGG - Intergenic
1026935785 7:74254510-74254532 GGGTTCCGGTGGTGCCCTGGCGG + Intergenic
1029689002 7:102168246-102168268 GAATTCATGTGGTGCCTGGGTGG - Intronic
1033049285 7:137989509-137989531 GGCTGAGTGTGGAGCCCTGGGGG - Intronic
1038367297 8:26948859-26948881 GGATTCCTGTGGTGCCAGGAAGG + Intergenic
1038412025 8:27366430-27366452 GGGTTCATGTGGTGCCATGTTGG + Intronic
1039698206 8:39935178-39935200 ACATTCTTGTGGTGGCCTGGTGG - Exonic
1043160549 8:76841124-76841146 GGATTTGTATGGTGCCTTTGAGG + Intronic
1044837156 8:96307074-96307096 GGATTAATGTGGGGCCCTAGAGG + Intronic
1051213132 9:14766593-14766615 GGATTCCTGTGGAGTCCTGAAGG - Intronic
1051362594 9:16294472-16294494 GGATTCCTGTGGTGCCAGGCAGG - Intergenic
1052731553 9:32291675-32291697 GGATTCCTGTGGTGCCAGGCAGG + Intergenic
1053451498 9:38197764-38197786 GCAGTCGTCTCGTGCCCTGGGGG + Intergenic
1056322821 9:85452491-85452513 GGATCCCTGTGGTGCCAGGGAGG + Intergenic
1058687801 9:107492969-107492991 GGATTAATGTGGAGCCATGGAGG + Intergenic
1060048374 9:120358994-120359016 GGATGAGTGAGGTACCCTGGTGG + Intergenic
1060816571 9:126638343-126638365 GGAGTCCTGGGGAGCCCTGGAGG - Intronic
1061514142 9:131078922-131078944 GGCTTTGTGTGGACCCCTGGAGG - Intronic
1185452266 X:288960-288982 GGGTTTGAGTGGTGCCCTGTGGG + Intronic
1187425708 X:19175740-19175762 GGGCTGGTGTGGTCCCCTGGAGG + Intergenic
1187681335 X:21770596-21770618 GGATTCCTGTGGTGCCAGGCAGG - Intergenic
1190025012 X:46913993-46914015 TGATTCCAGTGGTGGCCTGGAGG + Intronic
1190247191 X:48698453-48698475 GCCTTTGTTTGGTGCCCTGGAGG + Intronic
1190942580 X:55056582-55056604 GGATTGGAGTGATGGCCTGGGGG + Intergenic
1200207181 X:154325118-154325140 GGATTGGTGTGATGGCATGGGGG + Intronic