ID: 938904539

View in Genome Browser
Species Human (GRCh38)
Location 2:135825816-135825838
Sequence CTGTGGGCTGCGAGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938904539_938904550 0 Left 938904539 2:135825816-135825838 CCCTCTTCCCTCGCAGCCCACAG No data
Right 938904550 2:135825839-135825861 GAAGAGGCCCCTTCAAGGGGAGG No data
938904539_938904549 -3 Left 938904539 2:135825816-135825838 CCCTCTTCCCTCGCAGCCCACAG No data
Right 938904549 2:135825836-135825858 CAGGAAGAGGCCCCTTCAAGGGG No data
938904539_938904560 19 Left 938904539 2:135825816-135825838 CCCTCTTCCCTCGCAGCCCACAG No data
Right 938904560 2:135825858-135825880 GAGGGTGGGGTTCCAGGACAGGG No data
938904539_938904551 1 Left 938904539 2:135825816-135825838 CCCTCTTCCCTCGCAGCCCACAG No data
Right 938904551 2:135825840-135825862 AAGAGGCCCCTTCAAGGGGAGGG No data
938904539_938904565 28 Left 938904539 2:135825816-135825838 CCCTCTTCCCTCGCAGCCCACAG No data
Right 938904565 2:135825867-135825889 GTTCCAGGACAGGGAGGGAGGGG No data
938904539_938904564 27 Left 938904539 2:135825816-135825838 CCCTCTTCCCTCGCAGCCCACAG No data
Right 938904564 2:135825866-135825888 GGTTCCAGGACAGGGAGGGAGGG No data
938904539_938904554 6 Left 938904539 2:135825816-135825838 CCCTCTTCCCTCGCAGCCCACAG No data
Right 938904554 2:135825845-135825867 GCCCCTTCAAGGGGAGGGTGGGG No data
938904539_938904563 26 Left 938904539 2:135825816-135825838 CCCTCTTCCCTCGCAGCCCACAG No data
Right 938904563 2:135825865-135825887 GGGTTCCAGGACAGGGAGGGAGG No data
938904539_938904559 18 Left 938904539 2:135825816-135825838 CCCTCTTCCCTCGCAGCCCACAG No data
Right 938904559 2:135825857-135825879 GGAGGGTGGGGTTCCAGGACAGG No data
938904539_938904562 23 Left 938904539 2:135825816-135825838 CCCTCTTCCCTCGCAGCCCACAG No data
Right 938904562 2:135825862-135825884 GTGGGGTTCCAGGACAGGGAGGG No data
938904539_938904558 13 Left 938904539 2:135825816-135825838 CCCTCTTCCCTCGCAGCCCACAG No data
Right 938904558 2:135825852-135825874 CAAGGGGAGGGTGGGGTTCCAGG No data
938904539_938904547 -5 Left 938904539 2:135825816-135825838 CCCTCTTCCCTCGCAGCCCACAG No data
Right 938904547 2:135825834-135825856 CACAGGAAGAGGCCCCTTCAAGG No data
938904539_938904561 22 Left 938904539 2:135825816-135825838 CCCTCTTCCCTCGCAGCCCACAG No data
Right 938904561 2:135825861-135825883 GGTGGGGTTCCAGGACAGGGAGG No data
938904539_938904552 4 Left 938904539 2:135825816-135825838 CCCTCTTCCCTCGCAGCCCACAG No data
Right 938904552 2:135825843-135825865 AGGCCCCTTCAAGGGGAGGGTGG No data
938904539_938904553 5 Left 938904539 2:135825816-135825838 CCCTCTTCCCTCGCAGCCCACAG No data
Right 938904553 2:135825844-135825866 GGCCCCTTCAAGGGGAGGGTGGG No data
938904539_938904548 -4 Left 938904539 2:135825816-135825838 CCCTCTTCCCTCGCAGCCCACAG No data
Right 938904548 2:135825835-135825857 ACAGGAAGAGGCCCCTTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938904539 Original CRISPR CTGTGGGCTGCGAGGGAAGA GGG (reversed) Intronic
No off target data available for this crispr