ID: 938909955

View in Genome Browser
Species Human (GRCh38)
Location 2:135876634-135876656
Sequence GGGCCACGGCTACACTGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 74}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938909955_938909959 -9 Left 938909955 2:135876634-135876656 CCTGCGCAGTGTAGCCGTGGCCC 0: 1
1: 0
2: 0
3: 3
4: 74
Right 938909959 2:135876648-135876670 CCGTGGCCCGCGGGTATTTTTGG 0: 1
1: 0
2: 0
3: 3
4: 21
938909955_938909963 17 Left 938909955 2:135876634-135876656 CCTGCGCAGTGTAGCCGTGGCCC 0: 1
1: 0
2: 0
3: 3
4: 74
Right 938909963 2:135876674-135876696 CTGGAACAAGTTCGAATCTGAGG 0: 1
1: 0
2: 0
3: 4
4: 62
938909955_938909962 -2 Left 938909955 2:135876634-135876656 CCTGCGCAGTGTAGCCGTGGCCC 0: 1
1: 0
2: 0
3: 3
4: 74
Right 938909962 2:135876655-135876677 CCGCGGGTATTTTTGGCTGCTGG 0: 1
1: 0
2: 0
3: 9
4: 41
938909955_938909964 18 Left 938909955 2:135876634-135876656 CCTGCGCAGTGTAGCCGTGGCCC 0: 1
1: 0
2: 0
3: 3
4: 74
Right 938909964 2:135876675-135876697 TGGAACAAGTTCGAATCTGAGGG 0: 1
1: 0
2: 0
3: 5
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938909955 Original CRISPR GGGCCACGGCTACACTGCGC AGG (reversed) Intergenic
900343957 1:2202191-2202213 GGGCCAAGGCCACACGGTGCTGG - Intronic
900736944 1:4305062-4305084 GGGCCACAGCTTCCCTGCCCAGG - Intergenic
900993966 1:6110357-6110379 GGGCCAGGGCTGCACGGGGCAGG - Intronic
901411536 1:9087731-9087753 GGGCCAGGGCTACTCTCCGGTGG + Intronic
902080007 1:13814319-13814341 GGGCCTTGGCTGCACAGCGCAGG + Intronic
903278049 1:22233959-22233981 GGGCCACGGCTGCCCAGCGAGGG - Intergenic
905807025 1:40884537-40884559 GGACCCCGGCTGCACCGCGCTGG + Intergenic
906713628 1:47951272-47951294 GGGCCAGGGCCACAATGCGGGGG + Intronic
911332421 1:96540774-96540796 GGGCACCGTGTACACTGCGCAGG - Intergenic
914889761 1:151612274-151612296 GGGTCTGGGCTCCACTGCGCCGG + Exonic
915269845 1:154746271-154746293 GGGGCACGGGGCCACTGCGCAGG + Intronic
915522626 1:156456814-156456836 GGGCCTCAGCCTCACTGCGCTGG - Intergenic
1075102058 10:119513388-119513410 AGGCCAAGGCTGCACTGAGCCGG + Intronic
1076819985 10:132933447-132933469 GGGCCACGGCCACGCTTGGCCGG + Intronic
1092490420 12:8939923-8939945 GAGCCACAGCTACACTGGGAGGG - Exonic
1096946068 12:55411236-55411258 GAGCCACAGCTACACTGGGAGGG + Intergenic
1097983470 12:65758156-65758178 GGTCCACAGCTCCACTGCTCAGG - Intergenic
1101968434 12:109296242-109296264 GGGCCACAGCTCCCCAGCGCTGG - Intronic
1102228619 12:111247227-111247249 GGACCCCGGCTAGACTGGGCTGG + Intronic
1102246887 12:111361817-111361839 GGGCCATGGCTACCCAGCCCAGG + Exonic
1104856368 12:131904216-131904238 AGGCCACAGCTACAGTGAGCCGG - Intronic
1106253284 13:28000306-28000328 GAGCCACTGCGCCACTGCGCCGG + Intergenic
1109780674 13:67106905-67106927 GGGCCAAGGCTGCAGTGTGCTGG - Intronic
1114637377 14:24195510-24195532 CGGCTGCGGCTACACCGCGCTGG + Intronic
1118294843 14:64559374-64559396 CTGCCACTGCTACACTGGGCTGG + Intronic
1123435526 15:20251416-20251438 GGCCCACCACTACACGGCGCTGG - Intergenic
1130520608 15:84658257-84658279 GGGGCACGGCTCCGCTGCTCAGG - Exonic
1130964987 15:88690441-88690463 GGGCCCCAGCTGCACTGAGCAGG + Intergenic
1133284398 16:4683887-4683909 GGGCCTCGGCCACAGTGCTCGGG - Exonic
1133764979 16:8831681-8831703 GGTTCACTGCTACACTGCACAGG + Intronic
1139391665 16:66609440-66609462 GGGCCGCGGTGACACAGCGCAGG - Exonic
1139488396 16:67272050-67272072 GGGCCACTGCTCCATTGCTCTGG + Exonic
1148108437 17:45131761-45131783 CGGCCACAGCCACACTGCTCTGG - Intronic
1152242776 17:79168928-79168950 GGGCCACGGCTGCATTGCTACGG - Intronic
1152545140 17:80996684-80996706 AGGCCACGACTGCACTGCCCTGG - Intronic
1153794546 18:8609960-8609982 GCGCCACGGCGACCCTGGGCCGG + Intronic
1160340791 18:78087138-78087160 GGGCCTCCGCCACACTGCCCAGG - Intergenic
1160937806 19:1605447-1605469 CTGACCCGGCTACACTGCGCAGG + Exonic
1160968161 19:1755564-1755586 GAGCCACGACCAAACTGCGCGGG - Intronic
1162100577 19:8336137-8336159 GGGCCAGGGCTCCACTCCACAGG - Intronic
1165129050 19:33621183-33621205 GGCCCACGGCCACACAGCACCGG - Intergenic
1165328932 19:35130767-35130789 GGGCCAGGGCCACACAGAGCTGG - Intronic
1165486856 19:36101587-36101609 GGGCCAGGGCTACCCTTCCCTGG - Intronic
1167337546 19:48896189-48896211 GGGGCAGGGCTACAGAGCGCAGG - Intronic
934041922 2:88134235-88134257 GAGCCACGGCAGCACTGCCCTGG + Intergenic
936526783 2:113246830-113246852 GGGCCAGGTCTACGATGCGCTGG + Exonic
938909955 2:135876634-135876656 GGGCCACGGCTACACTGCGCAGG - Intergenic
942054805 2:172172601-172172623 GGGCCGCGGGGAAACTGCGCCGG - Intergenic
948229119 2:236336780-236336802 GGGCCACCGTAACACTGCACTGG - Intronic
1175511061 20:59526411-59526433 GGGCCCAGGCTACACAGCTCAGG + Intergenic
1176143427 20:63554896-63554918 GGGCCACAGCTGCACTCAGCCGG + Exonic
1180869809 22:19139768-19139790 GGGCCATGGGTACAATGCCCAGG - Intronic
1180871509 22:19149605-19149627 GGGCCGCGGCTACACTGGACTGG - Intronic
1181405506 22:22681724-22681746 GGGCCACAGCTGCACTGACCTGG - Intergenic
953886274 3:46715945-46715967 GGGCCAGTGGTACACTGGGCTGG - Intronic
954406088 3:50345740-50345762 GGGCCCAGGCCGCACTGCGCAGG - Exonic
957959114 3:87227116-87227138 GGGCCACGGCTTCTGTGCGCGGG - Intergenic
963870750 3:150410643-150410665 GGGCCATGGCTTCGCTGGGCTGG - Exonic
992758027 5:79927280-79927302 TTGCCACAGCTACACTGGGCTGG + Intergenic
995622205 5:114039024-114039046 TGGGCATGGCTACACTGGGCAGG + Intergenic
998601868 5:143592758-143592780 GGGCCAGGGCTCAACTGCGCAGG + Intergenic
1004767649 6:18748595-18748617 GGGCCACGGCCCCTCTGCCCAGG - Intergenic
1006796810 6:36737364-36737386 GGGCCACAGCCACATGGCGCAGG - Intergenic
1007816906 6:44531234-44531256 GGGCCAGCTCTACACTGGGCAGG - Intergenic
1007943506 6:45804248-45804270 TGGCCACGGCTACACTCTGGTGG + Intergenic
1013840107 6:114381509-114381531 GTGCCACTGCTACACAGCCCTGG - Intergenic
1014001671 6:116371491-116371513 GGGCCTCGGCTTCACTCTGCGGG + Intronic
1023653674 7:42397798-42397820 GGCTCACGGCTGCACTGCCCTGG - Intergenic
1034514300 7:151562287-151562309 GGGCCACGGCAGCTCTGTGCCGG + Intronic
1038584554 8:28777298-28777320 GGGCCACGGAACCACTGTGCTGG - Intronic
1039838803 8:41279000-41279022 AGGCCAAGGCTAGACTGGGCTGG - Intronic
1040567548 8:48581530-48581552 GGGCCACGCCGGCCCTGCGCTGG - Intergenic
1044832229 8:96261721-96261743 GGGCCCCGGCTACCCTTCTCCGG + Exonic
1049171900 8:141166806-141166828 GGGCCAGGGCTAAAGTGAGCAGG + Intronic
1049463832 8:142742126-142742148 GGGTCACGGCTCCACTCTGCAGG - Intronic
1062597127 9:137304438-137304460 GGGCCACAGCCACACTGCCGTGG - Intergenic
1195784719 X:108506783-108506805 GTGCCTAGGCTACACTGCACTGG + Intronic
1200146945 X:153931231-153931253 GGGCCGTGACTACACTGGGCAGG + Intronic