ID: 938910768

View in Genome Browser
Species Human (GRCh38)
Location 2:135883893-135883915
Sequence ACCCCCACATACCATGCCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938910768_938910770 12 Left 938910768 2:135883893-135883915 CCAAGGGCATGGTATGTGGGGGT No data
Right 938910770 2:135883928-135883950 TTCCTAATTAACAAGAATGAAGG No data
938910768_938910771 13 Left 938910768 2:135883893-135883915 CCAAGGGCATGGTATGTGGGGGT No data
Right 938910771 2:135883929-135883951 TCCTAATTAACAAGAATGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938910768 Original CRISPR ACCCCCACATACCATGCCCT TGG (reversed) Intergenic
No off target data available for this crispr