ID: 938910988

View in Genome Browser
Species Human (GRCh38)
Location 2:135885850-135885872
Sequence GAACCAGCTTATTTTAGTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938910985_938910988 4 Left 938910985 2:135885823-135885845 CCTTGGGGAAGTAGTGTAAATGT No data
Right 938910988 2:135885850-135885872 GAACCAGCTTATTTTAGTCAAGG No data
938910984_938910988 5 Left 938910984 2:135885822-135885844 CCCTTGGGGAAGTAGTGTAAATG No data
Right 938910988 2:135885850-135885872 GAACCAGCTTATTTTAGTCAAGG No data
938910980_938910988 26 Left 938910980 2:135885801-135885823 CCAGTCATGGGATGCAGGCTGCC No data
Right 938910988 2:135885850-135885872 GAACCAGCTTATTTTAGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938910988 Original CRISPR GAACCAGCTTATTTTAGTCA AGG Intergenic
No off target data available for this crispr