ID: 938912877

View in Genome Browser
Species Human (GRCh38)
Location 2:135901509-135901531
Sequence CTCCAGAGGATGCAGCAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938912868_938912877 30 Left 938912868 2:135901456-135901478 CCCTTTCTTGACCTTCTGTTCCT No data
Right 938912877 2:135901509-135901531 CTCCAGAGGATGCAGCAACAAGG No data
938912869_938912877 29 Left 938912869 2:135901457-135901479 CCTTTCTTGACCTTCTGTTCCTT No data
Right 938912877 2:135901509-135901531 CTCCAGAGGATGCAGCAACAAGG No data
938912873_938912877 3 Left 938912873 2:135901483-135901505 CCATGTGAGGATACAGCATTTAT No data
Right 938912877 2:135901509-135901531 CTCCAGAGGATGCAGCAACAAGG No data
938912870_938912877 19 Left 938912870 2:135901467-135901489 CCTTCTGTTCCTTCTGCCATGTG No data
Right 938912877 2:135901509-135901531 CTCCAGAGGATGCAGCAACAAGG No data
938912872_938912877 10 Left 938912872 2:135901476-135901498 CCTTCTGCCATGTGAGGATACAG No data
Right 938912877 2:135901509-135901531 CTCCAGAGGATGCAGCAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938912877 Original CRISPR CTCCAGAGGATGCAGCAACA AGG Intergenic