ID: 938921335

View in Genome Browser
Species Human (GRCh38)
Location 2:135997853-135997875
Sequence GAGTCCTTGGGGCAGTTATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938921335_938921340 17 Left 938921335 2:135997853-135997875 CCTGATAACTGCCCCAAGGACTC No data
Right 938921340 2:135997893-135997915 AGCTAATTATAAAATTTAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938921335 Original CRISPR GAGTCCTTGGGGCAGTTATC AGG (reversed) Intergenic
No off target data available for this crispr