ID: 938924229

View in Genome Browser
Species Human (GRCh38)
Location 2:136024571-136024593
Sequence TAGAGGCTGAGGCGGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 104212
Summary {0: 3, 1: 39, 2: 942, 3: 11583, 4: 91645}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938924229_938924240 15 Left 938924229 2:136024571-136024593 CCATCCTCCCGCCTCAGCCTCTA 0: 3
1: 39
2: 942
3: 11583
4: 91645
Right 938924240 2:136024609-136024631 CAGGCTCAGGCCACCATAACTGG No data
938924229_938924239 2 Left 938924229 2:136024571-136024593 CCATCCTCCCGCCTCAGCCTCTA 0: 3
1: 39
2: 942
3: 11583
4: 91645
Right 938924239 2:136024596-136024618 GTGGCTGGGACTACAGGCTCAGG No data
938924229_938924238 -4 Left 938924229 2:136024571-136024593 CCATCCTCCCGCCTCAGCCTCTA 0: 3
1: 39
2: 942
3: 11583
4: 91645
Right 938924238 2:136024590-136024612 TCTATAGTGGCTGGGACTACAGG 0: 2
1: 14
2: 827
3: 19979
4: 191732

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938924229 Original CRISPR TAGAGGCTGAGGCGGGAGGA TGG (reversed) Intergenic
Too many off-targets to display for this crispr