ID: 938924229 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:136024571-136024593 |
Sequence | TAGAGGCTGAGGCGGGAGGA TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 104212 | |||
Summary | {0: 3, 1: 39, 2: 942, 3: 11583, 4: 91645} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
938924229_938924240 | 15 | Left | 938924229 | 2:136024571-136024593 | CCATCCTCCCGCCTCAGCCTCTA | 0: 3 1: 39 2: 942 3: 11583 4: 91645 |
||
Right | 938924240 | 2:136024609-136024631 | CAGGCTCAGGCCACCATAACTGG | No data | ||||
938924229_938924239 | 2 | Left | 938924229 | 2:136024571-136024593 | CCATCCTCCCGCCTCAGCCTCTA | 0: 3 1: 39 2: 942 3: 11583 4: 91645 |
||
Right | 938924239 | 2:136024596-136024618 | GTGGCTGGGACTACAGGCTCAGG | No data | ||||
938924229_938924238 | -4 | Left | 938924229 | 2:136024571-136024593 | CCATCCTCCCGCCTCAGCCTCTA | 0: 3 1: 39 2: 942 3: 11583 4: 91645 |
||
Right | 938924238 | 2:136024590-136024612 | TCTATAGTGGCTGGGACTACAGG | 0: 2 1: 14 2: 827 3: 19979 4: 191732 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
938924229 | Original CRISPR | TAGAGGCTGAGGCGGGAGGA TGG (reversed) | Intergenic | ||
Too many off-targets to display for this crispr |