ID: 938928631

View in Genome Browser
Species Human (GRCh38)
Location 2:136066727-136066749
Sequence TTGAGAATGGACTCAGTGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938928631_938928637 3 Left 938928631 2:136066727-136066749 CCAAGCACTGAGTCCATTCTCAA No data
Right 938928637 2:136066753-136066775 TCACAGATGGAGGATGGAGGAGG No data
938928631_938928636 0 Left 938928631 2:136066727-136066749 CCAAGCACTGAGTCCATTCTCAA No data
Right 938928636 2:136066750-136066772 GATTCACAGATGGAGGATGGAGG No data
938928631_938928639 11 Left 938928631 2:136066727-136066749 CCAAGCACTGAGTCCATTCTCAA No data
Right 938928639 2:136066761-136066783 GGAGGATGGAGGAGGGTCTCAGG No data
938928631_938928635 -3 Left 938928631 2:136066727-136066749 CCAAGCACTGAGTCCATTCTCAA No data
Right 938928635 2:136066747-136066769 CAAGATTCACAGATGGAGGATGG No data
938928631_938928633 -10 Left 938928631 2:136066727-136066749 CCAAGCACTGAGTCCATTCTCAA No data
Right 938928633 2:136066740-136066762 CCATTCTCAAGATTCACAGATGG No data
938928631_938928641 25 Left 938928631 2:136066727-136066749 CCAAGCACTGAGTCCATTCTCAA No data
Right 938928641 2:136066775-136066797 GGTCTCAGGGAGTTAGCCCGTGG No data
938928631_938928642 28 Left 938928631 2:136066727-136066749 CCAAGCACTGAGTCCATTCTCAA No data
Right 938928642 2:136066778-136066800 CTCAGGGAGTTAGCCCGTGGAGG No data
938928631_938928640 12 Left 938928631 2:136066727-136066749 CCAAGCACTGAGTCCATTCTCAA No data
Right 938928640 2:136066762-136066784 GAGGATGGAGGAGGGTCTCAGGG No data
938928631_938928634 -7 Left 938928631 2:136066727-136066749 CCAAGCACTGAGTCCATTCTCAA No data
Right 938928634 2:136066743-136066765 TTCTCAAGATTCACAGATGGAGG No data
938928631_938928638 4 Left 938928631 2:136066727-136066749 CCAAGCACTGAGTCCATTCTCAA No data
Right 938928638 2:136066754-136066776 CACAGATGGAGGATGGAGGAGGG No data
938928631_938928643 29 Left 938928631 2:136066727-136066749 CCAAGCACTGAGTCCATTCTCAA No data
Right 938928643 2:136066779-136066801 TCAGGGAGTTAGCCCGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938928631 Original CRISPR TTGAGAATGGACTCAGTGCT TGG (reversed) Intergenic
No off target data available for this crispr