ID: 938928635

View in Genome Browser
Species Human (GRCh38)
Location 2:136066747-136066769
Sequence CAAGATTCACAGATGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938928630_938928635 -2 Left 938928630 2:136066726-136066748 CCCAAGCACTGAGTCCATTCTCA No data
Right 938928635 2:136066747-136066769 CAAGATTCACAGATGGAGGATGG No data
938928631_938928635 -3 Left 938928631 2:136066727-136066749 CCAAGCACTGAGTCCATTCTCAA No data
Right 938928635 2:136066747-136066769 CAAGATTCACAGATGGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938928635 Original CRISPR CAAGATTCACAGATGGAGGA TGG Intergenic
No off target data available for this crispr