ID: 938930877

View in Genome Browser
Species Human (GRCh38)
Location 2:136086071-136086093
Sequence TGGGGATCACAGGATAATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938930871_938930877 8 Left 938930871 2:136086040-136086062 CCTTGTATGAGTCAGACACTGTG No data
Right 938930877 2:136086071-136086093 TGGGGATCACAGGATAATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938930877 Original CRISPR TGGGGATCACAGGATAATGC AGG Intergenic
No off target data available for this crispr