ID: 938934508

View in Genome Browser
Species Human (GRCh38)
Location 2:136116855-136116877
Sequence CAGCCGCGGCGGCCCGGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938934508_938934525 30 Left 938934508 2:136116855-136116877 CCAGCCCCGGGCCGCCGCGGCTG No data
Right 938934525 2:136116908-136116930 CAGCGCTGCAGGGGCTCCGCTGG No data
938934508_938934521 20 Left 938934508 2:136116855-136116877 CCAGCCCCGGGCCGCCGCGGCTG No data
Right 938934521 2:136116898-136116920 CGCCCGCAAGCAGCGCTGCAGGG No data
938934508_938934520 19 Left 938934508 2:136116855-136116877 CCAGCCCCGGGCCGCCGCGGCTG No data
Right 938934520 2:136116897-136116919 CCGCCCGCAAGCAGCGCTGCAGG No data
938934508_938934522 21 Left 938934508 2:136116855-136116877 CCAGCCCCGGGCCGCCGCGGCTG No data
Right 938934522 2:136116899-136116921 GCCCGCAAGCAGCGCTGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938934508 Original CRISPR CAGCCGCGGCGGCCCGGGGC TGG (reversed) Intronic
No off target data available for this crispr