ID: 938936284

View in Genome Browser
Species Human (GRCh38)
Location 2:136130477-136130499
Sequence CAGTCGTTCTTAAGGAAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938936282_938936284 -1 Left 938936282 2:136130455-136130477 CCTTTATCTGTAAATTTTATCAC No data
Right 938936284 2:136130477-136130499 CAGTCGTTCTTAAGGAAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938936284 Original CRISPR CAGTCGTTCTTAAGGAAAAT AGG Intergenic
No off target data available for this crispr