ID: 938938701

View in Genome Browser
Species Human (GRCh38)
Location 2:136149700-136149722
Sequence CAGTGTGAACAACTGGCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938938696_938938701 -10 Left 938938696 2:136149687-136149709 CCACCAGGTAAGCCAGTGTGAAC No data
Right 938938701 2:136149700-136149722 CAGTGTGAACAACTGGCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938938701 Original CRISPR CAGTGTGAACAACTGGCTGA GGG Intergenic
No off target data available for this crispr