ID: 938940783

View in Genome Browser
Species Human (GRCh38)
Location 2:136167955-136167977
Sequence GGGATTTATTGCCCTGACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938940783_938940791 21 Left 938940783 2:136167955-136167977 CCTCAGTCAGGGCAATAAATCCC No data
Right 938940791 2:136167999-136168021 GGCTGTGCCTGAAAGATGCTGGG No data
938940783_938940792 27 Left 938940783 2:136167955-136167977 CCTCAGTCAGGGCAATAAATCCC No data
Right 938940792 2:136168005-136168027 GCCTGAAAGATGCTGGGCAGAGG No data
938940783_938940790 20 Left 938940783 2:136167955-136167977 CCTCAGTCAGGGCAATAAATCCC No data
Right 938940790 2:136167998-136168020 AGGCTGTGCCTGAAAGATGCTGG No data
938940783_938940794 28 Left 938940783 2:136167955-136167977 CCTCAGTCAGGGCAATAAATCCC No data
Right 938940794 2:136168006-136168028 CCTGAAAGATGCTGGGCAGAGGG No data
938940783_938940787 0 Left 938940783 2:136167955-136167977 CCTCAGTCAGGGCAATAAATCCC No data
Right 938940787 2:136167978-136168000 AAAGGAATATTCCCTGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938940783 Original CRISPR GGGATTTATTGCCCTGACTG AGG (reversed) Intergenic
No off target data available for this crispr