ID: 938940785

View in Genome Browser
Species Human (GRCh38)
Location 2:136167975-136167997
Sequence GCTGCAGGGAATATTCCTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938940785_938940791 1 Left 938940785 2:136167975-136167997 CCCAAAGGAATATTCCCTGCAGC No data
Right 938940791 2:136167999-136168021 GGCTGTGCCTGAAAGATGCTGGG No data
938940785_938940795 21 Left 938940785 2:136167975-136167997 CCCAAAGGAATATTCCCTGCAGC No data
Right 938940795 2:136168019-136168041 GGGCAGAGGGAGAACCAGATAGG No data
938940785_938940790 0 Left 938940785 2:136167975-136167997 CCCAAAGGAATATTCCCTGCAGC No data
Right 938940790 2:136167998-136168020 AGGCTGTGCCTGAAAGATGCTGG No data
938940785_938940794 8 Left 938940785 2:136167975-136167997 CCCAAAGGAATATTCCCTGCAGC No data
Right 938940794 2:136168006-136168028 CCTGAAAGATGCTGGGCAGAGGG No data
938940785_938940796 22 Left 938940785 2:136167975-136167997 CCCAAAGGAATATTCCCTGCAGC No data
Right 938940796 2:136168020-136168042 GGCAGAGGGAGAACCAGATAGGG No data
938940785_938940792 7 Left 938940785 2:136167975-136167997 CCCAAAGGAATATTCCCTGCAGC No data
Right 938940792 2:136168005-136168027 GCCTGAAAGATGCTGGGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938940785 Original CRISPR GCTGCAGGGAATATTCCTTT GGG (reversed) Intergenic