ID: 938940786

View in Genome Browser
Species Human (GRCh38)
Location 2:136167976-136167998
Sequence TGCTGCAGGGAATATTCCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938940786_938940796 21 Left 938940786 2:136167976-136167998 CCAAAGGAATATTCCCTGCAGCA No data
Right 938940796 2:136168020-136168042 GGCAGAGGGAGAACCAGATAGGG No data
938940786_938940794 7 Left 938940786 2:136167976-136167998 CCAAAGGAATATTCCCTGCAGCA No data
Right 938940794 2:136168006-136168028 CCTGAAAGATGCTGGGCAGAGGG No data
938940786_938940792 6 Left 938940786 2:136167976-136167998 CCAAAGGAATATTCCCTGCAGCA No data
Right 938940792 2:136168005-136168027 GCCTGAAAGATGCTGGGCAGAGG No data
938940786_938940791 0 Left 938940786 2:136167976-136167998 CCAAAGGAATATTCCCTGCAGCA No data
Right 938940791 2:136167999-136168021 GGCTGTGCCTGAAAGATGCTGGG No data
938940786_938940790 -1 Left 938940786 2:136167976-136167998 CCAAAGGAATATTCCCTGCAGCA No data
Right 938940790 2:136167998-136168020 AGGCTGTGCCTGAAAGATGCTGG No data
938940786_938940795 20 Left 938940786 2:136167976-136167998 CCAAAGGAATATTCCCTGCAGCA No data
Right 938940795 2:136168019-136168041 GGGCAGAGGGAGAACCAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938940786 Original CRISPR TGCTGCAGGGAATATTCCTT TGG (reversed) Intergenic