ID: 938940788

View in Genome Browser
Species Human (GRCh38)
Location 2:136167989-136168011
Sequence TTCAGGCACAGCCTGCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938940788_938940798 30 Left 938940788 2:136167989-136168011 CCCTGCAGCAGGCTGTGCCTGAA No data
Right 938940798 2:136168042-136168064 GCAAGCCAAGCGCTGAGAAGAGG No data
938940788_938940796 8 Left 938940788 2:136167989-136168011 CCCTGCAGCAGGCTGTGCCTGAA No data
Right 938940796 2:136168020-136168042 GGCAGAGGGAGAACCAGATAGGG No data
938940788_938940792 -7 Left 938940788 2:136167989-136168011 CCCTGCAGCAGGCTGTGCCTGAA No data
Right 938940792 2:136168005-136168027 GCCTGAAAGATGCTGGGCAGAGG No data
938940788_938940795 7 Left 938940788 2:136167989-136168011 CCCTGCAGCAGGCTGTGCCTGAA No data
Right 938940795 2:136168019-136168041 GGGCAGAGGGAGAACCAGATAGG No data
938940788_938940794 -6 Left 938940788 2:136167989-136168011 CCCTGCAGCAGGCTGTGCCTGAA No data
Right 938940794 2:136168006-136168028 CCTGAAAGATGCTGGGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938940788 Original CRISPR TTCAGGCACAGCCTGCTGCA GGG (reversed) Intergenic
No off target data available for this crispr