ID: 938940789

View in Genome Browser
Species Human (GRCh38)
Location 2:136167990-136168012
Sequence TTTCAGGCACAGCCTGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
938940789_938940799 30 Left 938940789 2:136167990-136168012 CCTGCAGCAGGCTGTGCCTGAAA No data
Right 938940799 2:136168043-136168065 CAAGCCAAGCGCTGAGAAGAGGG No data
938940789_938940792 -8 Left 938940789 2:136167990-136168012 CCTGCAGCAGGCTGTGCCTGAAA No data
Right 938940792 2:136168005-136168027 GCCTGAAAGATGCTGGGCAGAGG No data
938940789_938940796 7 Left 938940789 2:136167990-136168012 CCTGCAGCAGGCTGTGCCTGAAA No data
Right 938940796 2:136168020-136168042 GGCAGAGGGAGAACCAGATAGGG No data
938940789_938940794 -7 Left 938940789 2:136167990-136168012 CCTGCAGCAGGCTGTGCCTGAAA No data
Right 938940794 2:136168006-136168028 CCTGAAAGATGCTGGGCAGAGGG No data
938940789_938940795 6 Left 938940789 2:136167990-136168012 CCTGCAGCAGGCTGTGCCTGAAA No data
Right 938940795 2:136168019-136168041 GGGCAGAGGGAGAACCAGATAGG No data
938940789_938940798 29 Left 938940789 2:136167990-136168012 CCTGCAGCAGGCTGTGCCTGAAA No data
Right 938940798 2:136168042-136168064 GCAAGCCAAGCGCTGAGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
938940789 Original CRISPR TTTCAGGCACAGCCTGCTGC AGG (reversed) Intergenic
No off target data available for this crispr